T7 RNA Polymerase
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa. Promoter The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7 TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins at the asterisk-marked guanine. Structure T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and tra ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
RNA Polymerase
In molecular biology, RNA polymerase (abbreviated RNAP or RNApol), or more specifically DNA-directed/dependent RNA polymerase (DdRP), is an enzyme that synthesizes RNA from a DNA template. Using the enzyme helicase, RNAP locally opens the double-stranded DNA so that one strand of the exposed nucleotides can be used as a template for the synthesis of RNA, a process called transcription. A transcription factor and its associated transcription mediator complex must be attached to a DNA binding site called a promoter region before RNAP can initiate the DNA unwinding at that position. RNAP not only initiates RNA transcription, it also guides the nucleotides into position, facilitates attachment and elongation, has intrinsic proofreading and replacement capabilities, and termination recognition capability. In eukaryotes, RNAP can build chains as long as 2.4 million nucleotides. RNAP produces RNA that, functionally, is either for protein coding, i.e. messenger RNA (mRNA); or n ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
T7 Phage
Bacteriophage T7 (or the T7 phage) is a bacteriophage, a virus that infects bacteria. It infects most strains of ''Escherichia coli'' and relies on these hosts to propagate. Bacteriophage T7 has a lytic life cycle, meaning that it destroys the cell it infects. It also possesses several properties that make it an ideal phage for experimentation: its purification and concentration have produced consistent values in chemical analyses; it can be rendered noninfectious by exposure to UV light; and it can be used in phage display to clone RNA binding proteins. Discovery In a 1945 study by Demerec and Fano, T7 was used to describe one of the seven phage types (T1 to T7) that grow lytically on ''Escherichia coli;'' although all seven phages were numbered arbitrarily, phages with odd numbers, or T-odd phages, were later discovered to share morphological and biochemical features that distinguish them from T-even phages. Before being physically referred to as T7, the phage was used in p ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Bacteriophage
A bacteriophage (), also known informally as a ''phage'' (), is a duplodnaviria virus that infects and replicates within bacteria and archaea. The term was derived from "bacteria" and the Greek φαγεῖν ('), meaning "to devour". Bacteriophages are composed of proteins that encapsulate a DNA or RNA genome, and may have structures that are either simple or elaborate. Their genomes may encode as few as four genes (e.g. MS2) and as many as hundreds of genes. Phages replicate within the bacterium following the injection of their genome into its cytoplasm. Bacteriophages are among the most common and diverse entities in the biosphere. Bacteriophages are ubiquitous viruses, found wherever bacteria exist. It is estimated there are more than 1031 bacteriophages on the planet, more than every other organism on Earth, including bacteria, combined. Viruses are the most abundant biological entity in the water column of the world's oceans, and the second largest component of biom ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Promoter (biology)
In genetics, a promoter is a sequence of DNA to which proteins bind to initiate transcription of a single RNA transcript from the DNA downstream of the promoter. The RNA transcript may encode a protein (mRNA), or can have a function in and of itself, such as tRNA or rRNA. Promoters are located near the transcription start sites of genes, upstream on the DNA (towards the 5' region of the sense strand). Promoters can be about 100–1000 base pairs long, the sequence of which is highly dependent on the gene and product of transcription, type or class of RNA polymerase recruited to the site, and species of organism. Promoters control gene expression in bacteria and eukaryotes. RNA polymerase must attach to DNA near a gene for transcription to occur. Promoter DNA sequences provide an enzyme binding site. The -10 sequence is TATAAT. -35 sequences are conserved on average, but not in most promoters. Artificial promoters with conserved -10 and -35 elements transcribe more slowly. All D ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Protein Data Bank
The Protein Data Bank (PDB) is a database for the three-dimensional structural data of large biological molecules, such as proteins and nucleic acids. The data, typically obtained by X-ray crystallography, NMR spectroscopy, or, increasingly, cryo-electron microscopy, and submitted by biologists and biochemists from around the world, are freely accessible on the Internet via the websites of its member organisations (PDBe, PDBj, RCSB, and BMRB). The PDB is overseen by an organization called the Worldwide Protein Data Bank, wwPDB. The PDB is a key in areas of structural biology, such as structural genomics. Most major scientific journals and some funding agencies now require scientists to submit their structure data to the PDB. Many other databases use protein structures deposited in the PDB. For example, SCOP and CATH classify protein structures, while PDBsum provides a graphic overview of PDB entries using information from other sources, such as Gene ontology. History Two force ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Beta-hairpin
The beta hairpin (sometimes also called beta-ribbon or beta-beta unit) is a simple protein structural motif involving two beta strands that look like a hairpin. The motif consists of two strands that are adjacent in primary structure, oriented in an antiparallel direction (the N-terminus of one sheet is adjacent to the C-terminus of the next), and linked by a short loop of two to five amino acids. Beta hairpins can occur in isolation or as part of a series of hydrogen bonded strands that collectively comprise a beta sheet. Researchers such as Francisco Blanco ''et al.'' have used protein NMR to show that beta-hairpins can be formed from isolated short peptides in aqueous solution, suggesting that hairpins could form nucleation sites for protein folding. Classification Beta hairpins were originally categorized solely by the number of amino acid residues in their loop sequences, such that they were named one-residue, two-residue, etc. This system, however, is somewhat ambi ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
RNA-dependent RNA Polymerase
RNA-dependent RNA polymerase (RdRp) or RNA replicase is an enzyme that catalyzes the replication of RNA from an RNA template. Specifically, it catalyzes synthesis of the RNA strand complementary to a given RNA template. This is in contrast to typical DNA-dependent RNA polymerases, which all organisms use to catalyze the transcription of RNA from a DNA template. RdRp is an essential protein encoded in the genomes of most RNA-containing viruses with no DNA stage including SARS-CoV-2. Some eukaryotes also contain RdRps, which are involved in RNA interference and differ structurally from viral RdRps. History Viral RdRps were discovered in the early 1960s from studies on mengovirus and polio virus when it was observed that these viruses were not sensitive to actinomycin D, a drug that inhibits cellular DNA-directed RNA synthesis. This lack of sensitivity suggested that there is a virus-specific enzyme that could copy RNA from an RNA template and not from a DNA template. Distr ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
T7 DNA Polymerase
T7 DNA polymerase is an enzyme used during the DNA replication of the T7 bacteriophage. During this process, the DNA polymerase “reads” existing DNA strands and creates two new strands that match the existing ones. The T7 DNA polymerase requires a host factor, ''E. coli'' thioredoxin, in order to carry out its function. This helps stabilize the binding of the necessary protein to the primer-template to improve processivity by more than 100-fold, which is a feature unique to this enzyme. It is a member of the Family A DNA polymerases, which include ''E. coli'' DNA polymerase I and Taq DNA polymerase. This polymerase has various applications in site-directed mutagenesis as well as a high-fidelity enzyme suitable for PCR. It has also served as the precursor to Sequenase, an engineered-enzyme optimized for DNA sequencing. Mechanism Phosphoryl transfer Figure 2. Nucleotidyl transfer by DNA polymerase. T7 DNA polymerase catalyzes the phosphoryl transfer during DNA replicatio ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
POLRMT
POLRMT is a symbol of RNA polymerase mitochondrial It is a DNA-directed RNA polymerase, mitochondrial is an enzyme that in humans is encoded by the ''POLRMT'' gene. Function This gene encodes a mitochondrial DNA-directed RNA polymerase. The gene product is responsible for mitochondrial gene expression as well as for providing RNA primers for initiation of replication of the mitochondrial genome. Although this polypeptide has the same function as the three nuclear DNA-directed RNA polymerases, it is more closely related to RNA polymerases of bacteriophage (including T7 RNA polymerase), mitochondrial polymerases of lower eukaryotes as well as chloroplastic RpoT polymerases. Structure The structure of the enzyme has been solved. It exhibits an overall structure similar to that of phage RNAP, but the initiation mechanism is different in that it requires initiation factors TFAM (only in mammals) and TFB2M. Elongation requires the elongation factor TEFM. The exact termination proc ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Rifampicin
Rifampicin, also known as rifampin, is an ansamycin antibiotic used to treat several types of bacterial infections, including tuberculosis (TB), mycobacterium avium complex, ''Mycobacterium avium'' complex, leprosy, and Legionnaires’ disease. It is almost always used together with other antibiotics with two notable exceptions: when given as a "preferred treatment that is strongly recommended" for latent TB infection; and when used as post-exposure prophylaxis to prevent Haemophilus influenzae type b, ''Haemophilus influenzae'' type b and meningococcal disease in people who have been exposed to those bacteria. Before treating a person for a long period of time, measurements of liver enzymes and blood counts are recommended. Rifampicin may be given either Oral administration, by mouth or intravenously. Common side effects include nausea, vomiting, diarrhea, and loss of appetite. It often turns urine, sweat, and tears a red or orange color. Liver problems or allergic reactions ma ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Reverse Transcriptase
A reverse transcriptase (RT) is an enzyme used to generate complementary DNA (cDNA) from an RNA template, a process termed reverse transcription. Reverse transcriptases are used by viruses such as HIV and hepatitis B to replicate their genomes, by retrotransposon mobile genetic elements to proliferate within the host genome, and by eukaryotic cells to extend the telomeres at the ends of their linear chromosomes. Contrary to a widely held belief, the process does not violate the flows of genetic information as described by the classical central dogma, as transfers of information from RNA to DNA are explicitly held possible. Retroviral RT has three sequential biochemical activities: RNA-dependent DNA polymerase activity, ribonuclease H (RNase H), and DNA-dependent DNA polymerase activity. Collectively, these activities enable the enzyme to convert single-stranded RNA into double-stranded cDNA. In retroviruses and retrotransposons, this cDNA can then integrate into the host genom ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
DNA Polymerase
A DNA polymerase is a member of a family of enzymes that catalyze the synthesis of DNA molecules from nucleoside triphosphates, the molecular precursors of DNA. These enzymes are essential for DNA replication and usually work in groups to create two identical DNA duplexes from a single original DNA duplex. During this process, DNA polymerase "reads" the existing DNA strands to create two new strands that match the existing ones. These enzymes catalyze the chemical reaction : deoxynucleoside triphosphate + DNAn pyrophosphate + DNAn+1. DNA polymerase adds nucleotides to the three prime (3')-end of a DNA strand, one nucleotide at a time. Every time a cell divides, DNA polymerases are required to duplicate the cell's DNA, so that a copy of the original DNA molecule can be passed to each daughter cell. In this way, genetic information is passed down from generation to generation. Before replication can take place, an enzyme called helicase unwinds the DNA molecule from its tightl ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |