|
Spiegelman Monster
Spiegelman's Monster is the name given to an RNA chain of only 218 nucleotides that is able to be reproduced by the RNA replication enzyme RNA-dependent RNA polymerase, also called RNA replicase. It is named after its creator, Sol Spiegelman, of the University of Illinois at Urbana-Champaign who first described it in 1965. Description Spiegelman introduced RNA from a simple bacteriophage Qβ (Qβ) into a solution which contained Qβ's RNA replicase, some free nucleotides, and some salts. In this environment, the RNA started to be replicated. After a while, Spiegelman took some RNA and moved it to another tube with fresh solution. This process was repeated. Shorter RNA chains were able to be replicated faster, so the RNA became shorter and shorter as selection favored speed. After 74 generations, the original strand with 4,500 nucleotide bases ended up as a dwarf genome with only 218 bases. This short RNA sequence replicated very quickly in these unnatural circumstances. Further ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Nucleotides
Nucleotides are organic molecules consisting of a nucleoside and a phosphate. They serve as monomeric units of the nucleic acid polymers – deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), both of which are essential biomolecules within all life-forms on Earth. Nucleotides are obtained in the diet and are also synthesized from common nutrients by the liver. Nucleotides are composed of three subunit molecules: a nucleobase, a five-carbon sugar (ribose or deoxyribose), and a phosphate group consisting of one to three phosphates. The four nucleobases in DNA are guanine, adenine, cytosine and thymine; in RNA, uracil is used in place of thymine. Nucleotides also play a central role in metabolism at a fundamental, cellular level. They provide chemical energy—in the form of the nucleoside triphosphates, adenosine triphosphate (ATP), guanosine triphosphate (GTP), cytidine triphosphate (CTP) and uridine triphosphate (UTP)—throughout the cell for the many cellular fun ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Reverse Transcriptase
A reverse transcriptase (RT) is an enzyme used to generate complementary DNA (cDNA) from an RNA template, a process termed reverse transcription. Reverse transcriptases are used by viruses such as HIV and hepatitis B to replicate their genomes, by retrotransposon mobile genetic elements to proliferate within the host genome, and by eukaryotic cells to extend the telomeres at the ends of their linear chromosomes. Contrary to a widely held belief, the process does not violate the flows of genetic information as described by the classical central dogma, as transfers of information from RNA to DNA are explicitly held possible. Retroviral RT has three sequential biochemical activities: RNA-dependent DNA polymerase activity, ribonuclease H (RNase H), and DNA-dependent DNA polymerase activity. Collectively, these activities enable the enzyme to convert single-stranded RNA into double-stranded cDNA. In retroviruses and retrotransposons, this cDNA can then integrate into the host genom ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Viroid
Viroids are small single-stranded, circular RNAs that are infectious pathogens. Unlike viruses, they have no protein coating. All known viroids are inhabitants of angiosperms (flowering plants), and most cause diseases, whose respective economic importance to humans varies widely. The first discoveries of viroids in the 1970s triggered the historically third major extension of the biosphere—to include smaller lifelike entities —after the discoveries in 1675 by Antonie van Leeuwenhoek (of the "subvisible" microorganisms) and in 1892–1898 by Dmitri Iosifovich Ivanovsky and Martinus Beijerinck (of the "submicroscopic" viruses). The unique properties of viroids have been recognized by the International Committee on Taxonomy of Viruses, in creating a new order of subviral agents. The first recognized viroid, the pathogenic agent of the potato spindle tuber disease, was discovered, initially molecularly characterized, and named by Theodor Otto Diener, plant pathologist a ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
PAH World Hypothesis
The PAH world hypothesis is a speculative hypothesis that proposes that polycyclic aromatic hydrocarbons (PAHs), known to be abundant in the universe, including in comets, and assumed to be abundant in the primordial soup of the early Earth, played a major role in the origin of life by mediating the synthesis of RNA molecules, leading into the RNA world. However, as yet, the hypothesis is untested. Background The 1952 Miller–Urey experiment demonstrated the synthesis of organic compounds, such as amino acids, formaldehyde and sugars, from the original inorganic precursors the researchers presumed to have been present in the primordial soup (but is no longer considered likely). This experiment inspired many others. In 1961, Joan Oró found that the nucleotide base adenine could be made from hydrogen cyanide (HCN) and ammonia in a water solution. Experiments conducted later showed that the other RNA and DNA nucleobases could be obtained through simulated prebiotic chemistry with ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
RNA World Hypothesis
The RNA world is a hypothetical stage in the evolutionary history of life on Earth, in which self-replicating RNA molecules proliferated before the evolution of DNA and proteins. The term also refers to the hypothesis that posits the existence of this stage. Alexander Rich first proposed the concept of the RNA world in 1962, and Walter Gilbert coined the term in 1986. Alternative chemical paths to life have been proposed, and RNA-based life may not have been the first life to exist. Even so, the evidence for an RNA world is strong enough that the hypothesis has gained wide acceptance. The concurrent formation of all four RNA building blocks further strengthened the hypothesis. Regardless of its plausibility in a prebiotic scenario, the RNA world can serve as a model system for studying the origin of life. Like DNA, RNA can store and replicate genetic information; like protein enzymes, RNA enzymes (ribozymes) can catalyze (start or accelerate) chemical reactions that are crit ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Abiogenesis
In biology, abiogenesis (from a- 'not' + Greek bios 'life' + genesis 'origin') or the origin of life is the natural process by which life has arisen from non-living matter, such as simple organic compounds. The prevailing scientific hypothesis is that the transition from non-living to living entities on Earth was not a single event, but an evolutionary process of increasing complexity that involved the formation of a habitable planet, the prebiotic synthesis of organic molecules, molecular self-replication, self-assembly, autocatalysis, and the emergence of cell membranes. Many proposals have been made for different stages of the process. The study of abiogenesis aims to determine how pre-life chemical reactions gave rise to life under conditions strikingly different from those on Earth today. It primarily uses tools from biology and chemistry, with more recent approaches attempting a synthesis of many sciences. Life functions through the specialized chemistry of carbon and ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Origins Of Life And Evolution Of Biospheres
''Origins of Life and Evolution of Biospheres'' is a peer-reviewed scientific journal established in 1968 covering astrobiology and origins of life research. It is the official journal of the International Society for the Study of the Origin of Life. The journal's scope includes research on the origin, evolution, distribution, and future of life on Earth and beyond. Some examples of areas of interest are: prebiotic chemistry and the nature of Earth's early environment, self-replicating and self-organizing systems, the RNA world hypothesis and of other possible precursor systems, and the problem of the origin of the genetic code. According to the ''Journal Citation Reports'', the journal has a 2016 impact factor The impact factor (IF) or journal impact factor (JIF) of an academic journal is a scientometric index calculated by Clarivate that reflects the yearly mean number of citations of articles published in the last two years in a given journal, as i ... of 1.000. Abstracting ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
T7 RNA Polymerase
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa. Promoter The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7 TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins at the asterisk-marked guanine. Structure T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and tra ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Environmental RNA
Environmental DNA or eDNA is DNA that is collected from a variety of environmental samples such as soil, seawater, snow or air, rather than directly sampled from an individual organism. As various organisms interact with the environment, DNA is expelled and accumulates in their surroundings from various sources. In recent years, eDNA has been used as a tool to detect endangered wildlife that were otherwise unseen. In 2020, human health researchers began repurposing eDNA techniques to track the COVID-19 pandemic. Example sources of eDNA include, but are not limited to, feces, mucus, gametes, shed skin, carcasses and hair. Samples can be analyzed by high-throughput DNA sequencing methods, known as metagenomics, metabarcoding, and single-species detection, for rapid monitoring and measurement of biodiversity. In order to better differentiate between organisms within a sample, DNA metabarcoding is used in which the sample is analyzed and uses previously studied DNA libraries, ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
RNA-dependent RNA Polymerase
RNA-dependent RNA polymerase (RdRp) or RNA replicase is an enzyme that catalyzes the replication of RNA from an RNA template. Specifically, it catalyzes synthesis of the RNA strand complementary to a given RNA template. This is in contrast to typical DNA-dependent RNA polymerases, which all organisms use to catalyze the transcription of RNA from a DNA template. RdRp is an essential protein encoded in the genomes of most RNA-containing viruses with no DNA stage including SARS-CoV-2. Some eukaryotes also contain RdRps, which are involved in RNA interference and differ structurally from viral RdRps. History Viral RdRps were discovered in the early 1960s from studies on mengovirus and polio virus when it was observed that these viruses were not sensitive to actinomycin D, a drug that inhibits cellular DNA-directed RNA synthesis. This lack of sensitivity suggested that there is a virus-specific enzyme that could copy RNA from an RNA template and not from a DNA template. Distr ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Nucleobase
Nucleobases, also known as ''nitrogenous bases'' or often simply ''bases'', are nitrogen-containing biological compounds that form nucleosides, which, in turn, are components of nucleotides, with all of these monomers constituting the basic building blocks of nucleic acids. The ability of nucleobases to form base pairs and to stack one upon another leads directly to long-chain helical structures such as ribonucleic acid (RNA) and deoxyribonucleic acid (DNA). Five nucleobases—adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U)—are called ''primary'' or ''canonical''. They function as the fundamental units of the genetic code, with the bases A, G, C, and T being found in DNA while A, G, C, and U are found in RNA. Thymine and uracil are distinguished by merely the presence or absence of a methyl group on the fifth carbon (C5) of these heterocyclic six-membered rings. In addition, some viruses have aminoadenine (Z) instead of adenine. It differs in having an ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Manfred Eigen
Manfred Eigen (; 9 May 1927 – 6 February 2019) was a German Biophysical chemistry, biophysical chemist who won the 1967 Nobel Prize in Chemistry for work on measuring fast chemical reactions. Eigen's research helped solve major problems in physical chemistry and aided in the understanding of chemical processes that occur in living organisms. In later years, he explored the biochemical roots of life and evolution. He worked to install a multidisciplinary program at the Max Planck Institute to study the underpinnings of life at the molecular level. His work was hailed for creating a new scientific and technological discipline: evolutionary biotechnology. Education and early life Eigen was born on 9 May 1927 in Bochum, the son of Hedwig (Feld) and Ernst Eigen, a chamber musician. As a child he developed a deep passion for music, and studied piano. World War II interrupted his formal education. At age fifteen he was drafted into service in a German antiaircraft unit. He was ca ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
