|
Operon Theory
In genetics, an operon is a functioning unit of DNA containing a cluster of genes under the control of a single promoter. The genes are transcribed together into an mRNA strand and either translated together in the cytoplasm, or undergo splicing to create monocistronic mRNAs that are translated separately, i.e. several strands of mRNA that each encode a single gene product. The result of this is that the genes contained in the operon are either expressed together or not at all. Several genes must be ''co-transcribed'' to define an operon. Originally, operons were thought to exist solely in prokaryotes (which includes organelles like plastids that are derived from bacteria), but since the discovery of the first operons in eukaryotes in the early 1990s, more evidence has arisen to suggest they are more common than previously assumed. In general, expression of prokaryotic operons leads to the generation of polycistronic mRNAs, while eukaryotic operons lead to monocistronic mRNAs ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Operon 1
In genetics, an operon is a functioning unit of DNA containing a cluster of genes under the control of a single promoter. The genes are transcribed together into an mRNA strand and either translated together in the cytoplasm, or undergo splicing to create monocistronic mRNAs that are translated separately, i.e. several strands of mRNA that each encode a single gene product. The result of this is that the genes contained in the operon are either expressed together or not at all. Several genes must be ''co-transcribed'' to define an operon. Originally, operons were thought to exist solely in prokaryotes (which includes organelles like plastids that are derived from bacteria), but since the discovery of the first operons in eukaryotes in the early 1990s, more evidence has arisen to suggest they are more common than previously assumed. In general, expression of prokaryotic operons leads to the generation of polycistronic mRNAs, while eukaryotic operons lead to monocistronic mRNAs ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
T7 RNA Polymerase
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa. Promoter The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7 TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins at the asterisk-marked guanine. Structure T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and tra ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Drosophila
''Drosophila'' () is a genus of flies, belonging to the family Drosophilidae, whose members are often called "small fruit flies" or (less frequently) pomace flies, vinegar flies, or wine flies, a reference to the characteristic of many species to linger around overripe or rotting fruit. They should not be confused with the Tephritidae, a related family, which are also called fruit flies (sometimes referred to as "true fruit flies"); tephritids feed primarily on unripe or ripe fruit, with many species being regarded as destructive agricultural pests, especially the Mediterranean fruit fly. One species of ''Drosophila'' in particular, ''D. melanogaster'', has been heavily used in research in genetics and is a common model organism in developmental biology. The terms "fruit fly" and "''Drosophila''" are often used synonymously with ''D. melanogaster'' in modern biological literature. The entire genus, however, contains more than 1,500 species and is very diverse in appearance, be ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Caenorhabditis Elegans
''Caenorhabditis elegans'' () is a free-living transparent nematode about 1 mm in length that lives in temperate soil environments. It is the type species of its genus. The name is a blend of the Greek ''caeno-'' (recent), ''rhabditis'' (rod-like) and Latin ''elegans'' (elegant). In 1900, Maupas initially named it '' Rhabditides elegans.'' Osche placed it in the subgenus ''Caenorhabditis'' in 1952, and in 1955, Dougherty raised ''Caenorhabditis'' to the status of genus. ''C. elegans'' is an unsegmented pseudocoelomate and lacks respiratory or circulatory systems. Most of these nematodes are hermaphrodites and a few are males. Males have specialised tails for mating that include spicules. In 1963, Sydney Brenner proposed research into ''C. elegans,'' primarily in the area of neuronal development. In 1974, he began research into the molecular and developmental biology of ''C. elegans'', which has since been extensively used as a model organism. It was the first multicellu ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Nematode
The nematodes ( or grc-gre, Νηματώδη; la, Nematoda) or roundworms constitute the phylum Nematoda (also called Nemathelminthes), with plant-Parasitism, parasitic nematodes also known as eelworms. They are a diverse animal phylum inhabiting a broad range of environments. Less formally, they are categorized as Helminths, but are taxonomically classified along with Arthropod, arthropods, Tardigrade, tardigrades and other moulting animalia, animals in the clade Ecdysozoa, and unlike platyhelminthe, flatworms, have tubular digestion, digestive systems with openings at both ends. Like tardigrades, they have a reduced number of Hox genes, but their sister phylum Nematomorpha has kept the ancestral protostome Hox genotype, which shows that the reduction has occurred within the nematode phylum. Nematode species can be difficult to distinguish from one another. Consequently, estimates of the number of nematode species described to date vary by author and may change rapidly over ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Jacques Monod
Jacques Lucien Monod (February 9, 1910 – May 31, 1976) was a French biochemist who won the Nobel Prize in Physiology or Medicine in 1965, sharing it with François Jacob and André Lwoff "for their discoveries concerning genetic control of enzyme and virus synthesis".'' Chance and Necessity: An Essay on the Natural Philosophy of Modern Biology'' by Jacques Monod, New York, Alfred A. Knopf, 1971, Monod and Jacob became famous for their work on the '' E. coli'' ''lac'' operon, which encodes proteins necessary for the transport and breakdown of the sugar lactose (lac). From their own work and the work of others, they came up with a model for how the levels of some proteins in a cell are controlled. In their model, the manufacture of proteins, such as the ones encoded within the ''lac'' (lactose) operon, is prevented when a repressor, encoded by a regulatory gene, binds to its operator, a specific site in the DNA sequence that is close to the genes encoding the proteins. (It is ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
André Michel Lwoff
André Michel Lwoff (8 May 1902 – 30 September 1994) was a French microbiologist and Nobel laureate of Russian-Polish origin. Education, early life and career Lwoff was born in Ainay-le-Château, Allier, in Auvergne, France, the son of Marie (Siminovitch), an artist, and Solomon Lwoff, a psychiatrist. He joined the Institute Pasteur in Paris when he was 19 years old. In 1932, he finished his PhD and, with the help of a grant from the Rockefeller Foundation, moved with his wife and co-researcher Marguerite Lwoff to the Kaiser Wilhelm Institute for Medical Research of Heidelberg to Otto Meyerhof, where he did research on the development of flagellates. Another Rockefeller grant allowed him go to the University of Cambridge in 1937. In 1938, he was appointed departmental head at the Institut Pasteur, where he did groundbreaking research on bacteriophages, microbiota and on the poliovirus. Awards and honors He was awarded numerous prizes from the French Académie des Sciences, the ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
François Jacob
François Jacob (17 June 1920 – 19 April 2013) was a French biologist who, together with Jacques Monod, originated the idea that control of enzyme levels in all cells occurs through regulation of transcription. He shared the 1965 Nobel Prize in Medicine with Jacques Monod and André Lwoff. Early years Jacob was born the only child of Simon, a merchant, and Thérèse (Franck) Jacob, in Nancy, France. An inquisitive child, he learned to read at a young age. Albert Franck, Jacob's maternal grandfather, a four-star general, was Jacob's childhood role model. At seven he entered the Lycée Carnot, where he was schooled for the next ten years; in his autobiography he describes his impression of it: "a cage". He was antagonized by rightist youth at the Lycée Carnot around 1934. He describes his father as a "conformist in religion", while his mother and other family members important in his childhood were secular Jews; shortly after his bar mitzvah he became an atheist. Though ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Nobel Prize In Physiology And Medicine
The Nobel Prize in Physiology or Medicine is awarded yearly by the Nobel Assembly at the Karolinska Institute for outstanding discoveries in physiology or medicine. The Nobel Prize is not a single prize, but five separate prizes that, according to Alfred Nobel's 1895 will, are awarded "to those who, during the preceding year, have conferred the greatest benefit to humankind". Nobel Prizes are awarded in the fields of Physics, Chemistry, Physiology or Medicine, Literature, and Peace. The Nobel Prize is presented annually on the anniversary of Alfred Nobel's death, 10 December. As of 2022, 114 Nobel Prizes in Physiology or Medicine have been awarded to 226 laureates, 214 men and 12 women. The first one was awarded in 1901 to the German physiologist, Emil von Behring, for his work on serum therapy and the development of a vaccine against diphtheria. The first woman to receive the Nobel Prize in Physiology or Medicine, Gerty Cori, received it in 1947 for her role in elucidating the ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Escherichia Coli
''Escherichia coli'' (),Wells, J. C. (2000) Longman Pronunciation Dictionary. Harlow ngland Pearson Education Ltd. also known as ''E. coli'' (), is a Gram-negative, facultative anaerobic, rod-shaped, coliform bacterium of the genus ''Escherichia'' that is commonly found in the lower intestine of warm-blooded organisms. Most ''E. coli'' strains are harmless, but some serotypes ( EPEC, ETEC etc.) can cause serious food poisoning in their hosts, and are occasionally responsible for food contamination incidents that prompt product recalls. Most strains do not cause disease in humans and are part of the normal microbiota of the gut; such strains are harmless or even beneficial to humans (although these strains tend to be less studied than the pathogenic ones). For example, some strains of ''E. coli'' benefit their hosts by producing vitamin K2 or by preventing the colonization of the intestine by pathogenic bacteria. These mutually beneficial relationships between ''E. col ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Lac Operon
The ''lactose'' operon (''lac'' operon) is an operon required for the transport and metabolism of lactose in ''E. coli'' and many other enteric bacteria. Although glucose is the preferred carbon source for most bacteria, the ''lac'' operon allows for the effective digestion of lactose when glucose is not available through the activity of beta-galactosidase. Gene regulation of the ''lac'' operon was the first genetic regulatory mechanism to be understood clearly, so it has become a foremost example of prokaryotic gene regulation. It is often discussed in introductory molecular and cellular biology classes for this reason. This lactose metabolism system was used by François Jacob and Jacques Monod to determine how a biological cell knows which enzyme to synthesize. Their work on the ''lac'' operon won them the Nobel Prize in Physiology in 1965. Bacterial operons are polycistronic transcripts that are able to produce multiple proteins from one mRNA transcript. In this case, when l ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Operator (biology)
In genetics, an operon is a functioning unit of DNA containing a cluster of genes under the control of a single promoter. The genes are transcribed together into an mRNA strand and either translated together in the cytoplasm, or undergo splicing to create monocistronic mRNAs that are translated separately, i.e. several strands of mRNA that each encode a single gene product. The result of this is that the genes contained in the operon are either expressed together or not at all. Several genes must be ''co-transcribed'' to define an operon. Originally, operons were thought to exist solely in prokaryotes (which includes organelles like plastids that are derived from bacteria), but since the discovery of the first operons in eukaryotes in the early 1990s, more evidence has arisen to suggest they are more common than previously assumed. In general, expression of prokaryotic operons leads to the generation of polycistronic mRNAs, while eukaryotic operons lead to monocistronic mRNAs ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
