Mesodinium
Mesodinium is a genus of ciliates that are widely distributed and are abundant in marine and brackish waters. Currently, six marine species of ''Mesodinium'' have been described and grouped by nutritional mode: plastidic (''M. chamaeleon'', ''M. coatsi'', ''M. major'', and ''M. rubrum'') or heterotrophic (''M. pulex'' and ''M. pupula''). There is some debate as to whether the nutritional mode of plastidic ''Mesodinium ''species is phototrophic (permanent plastid) or mixotrophic. Among the plastidic species, wild ''M. major'' and ''M. rubrum'' populations possess red plastids belonging to genera ''Teleaulax'', ''Plagioselmis'', and ''Geminigera'', while wild ''M. chamaeleon'' and ''M. coatsi'' populations normally contain green plastids.Moestrup, Ø., Garcia-Cuetos, L., Hansen, P. J. & Fenchel, T. (2012) Studies on the genus Mesodinium I: ultrastructure and description of Mesodinium chamaeleon n. sp., a benthic marine species with green or red chloroplasts. J. Eukaryot. Microbiol. ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Mesodinium Coatsi
Mesodinium is a genus of ciliates that are widely distributed and are abundant in marine and brackish waters. Currently, six marine species of ''Mesodinium'' have been described and grouped by nutritional mode: plastidic (''M. chamaeleon'', ''M. coatsi'', ''M. major'', and ''M. rubrum'') or heterotrophic (''M. pulex'' and ''M. pupula''). There is some debate as to whether the nutritional mode of plastidic ''Mesodinium ''species is phototrophic (permanent plastid) or mixotrophic. Among the plastidic species, wild ''M. major'' and ''M. rubrum'' populations possess red plastids belonging to genera ''Teleaulax'', ''Plagioselmis'', and ''Geminigera'', while wild ''M. chamaeleon'' and ''M. coatsi'' populations normally contain green plastids.Moestrup, Ø., Garcia-Cuetos, L., Hansen, P. J. & Fenchel, T. (2012) Studies on the genus Mesodinium I: ultrastructure and description of Mesodinium chamaeleon n. sp., a benthic marine species with green or red chloroplasts. J. Eukaryot. Microbiol. ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Mesodinium Pupula
Mesodinium is a genus of ciliates that are widely distributed and are abundant in marine and brackish waters. Currently, six marine species of ''Mesodinium'' have been described and grouped by nutritional mode: plastidic (''M. chamaeleon'', ''M. coatsi'', ''M. major'', and ''M. rubrum'') or heterotrophic (''M. pulex'' and ''M. pupula''). There is some debate as to whether the nutritional mode of plastidic ''Mesodinium ''species is phototrophic (permanent plastid) or mixotrophic. Among the plastidic species, wild ''M. major'' and ''M. rubrum'' populations possess red plastids belonging to genera ''Teleaulax'', ''Plagioselmis'', and ''Geminigera'', while wild ''M. chamaeleon'' and ''M. coatsi'' populations normally contain green plastids.Moestrup, Ø., Garcia-Cuetos, L., Hansen, P. J. & Fenchel, T. (2012) Studies on the genus Mesodinium I: ultrastructure and description of Mesodinium chamaeleon n. sp., a benthic marine species with green or red chloroplasts. J. Eukaryot. Microbiol. ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Mesodinium Pulex
Mesodinium is a genus of ciliates that are widely distributed and are abundant in marine and brackish waters. Currently, six marine species of ''Mesodinium'' have been described and grouped by nutritional mode: plastidic (''M. chamaeleon'', ''M. coatsi'', ''M. major'', and ''M. rubrum'') or heterotrophic (''M. pulex'' and ''M. pupula''). There is some debate as to whether the nutritional mode of plastidic ''Mesodinium ''species is phototrophic (permanent plastid) or mixotrophic. Among the plastidic species, wild ''M. major'' and ''M. rubrum'' populations possess red plastids belonging to genera ''Teleaulax'', ''Plagioselmis'', and ''Geminigera'', while wild ''M. chamaeleon'' and ''M. coatsi'' populations normally contain green plastids.Moestrup, Ø., Garcia-Cuetos, L., Hansen, P. J. & Fenchel, T. (2012) Studies on the genus Mesodinium I: ultrastructure and description of Mesodinium chamaeleon n. sp., a benthic marine species with green or red chloroplasts. J. Eukaryot. Microbiol. ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Mesodinium Major
Mesodinium is a genus of ciliates that are widely distributed and are abundant in marine and brackish waters. Currently, six marine species of ''Mesodinium'' have been described and grouped by nutritional mode: plastidic (''M. chamaeleon'', ''M. coatsi'', ''M. major'', and ''M. rubrum'') or heterotrophic (''M. pulex'' and ''M. pupula''). There is some debate as to whether the nutritional mode of plastidic ''Mesodinium ''species is phototrophic (permanent plastid) or mixotrophic. Among the plastidic species, wild ''M. major'' and ''M. rubrum'' populations possess red plastids belonging to genera ''Teleaulax'', ''Plagioselmis'', and ''Geminigera'', while wild ''M. chamaeleon'' and ''M. coatsi'' populations normally contain green plastids.Moestrup, Ø., Garcia-Cuetos, L., Hansen, P. J. & Fenchel, T. (2012) Studies on the genus Mesodinium I: ultrastructure and description of Mesodinium chamaeleon n. sp., a benthic marine species with green or red chloroplasts. J. Eukaryot. Microbiol. ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Mesodinium Chamaeleon
''Mesodinium chamaeleon'' is a ciliate of the genus ''Mesodinium''. It is known for being able to consume and maintain algae endosymbiotically for days before digesting the algae. It has the ability to eat red and green algae, and afterwards using the chlorophyll granules from the algae to generate energy, turning itself from being a heterotroph into an autotroph. The species was discovered in January 2012 outside the coast of Nivå, Denmark by professor Øjvind Moestrup. In contrast to certain other species of the genus, ''Mesodinium chamaeleon'' can be maintained in culture for short periods only. It captures and ingests flagellates including cryptomonads. The prey is ingested very rapidly into a food vacuole without the cryptomonad flagella being shed and the trichocysts being discharged. The individual food vacuoles subsequently serve as photosynthetic units, each containing the cryptomonad chloroplast, a nucleus, and some mitochondria. The ingested cells are eventually d ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Mesodinium Rubrum
''Mesodinium rubrum'' (or ''Myrionecta rubra'') is a species of ciliates. It constitutes a plankton community and is found throughout the year, most abundantly in spring and fall, in coastal areas. Although discovered in 1908, its scientific importance came into light in the late 1960s when it attracted scientists by the recurrent red colouration it caused by forming massive blooms, that cause red tides in the oceans. Unlike typical protozoans, ''M. rubrum'' can make its own nutrition by photosynthesis. The unusual autotrophic property was discovered in 2006 when genetic sequencing revealed that the photosynthesising organelles, plastids, were derived from the principal food of the ciliate, the photosynthetic algae called cryptomonads (or cryptophytes). It is, thus, both autotrophic and heterotrophic. This nature also indicates that it is an example of endosymbiosis, supporting the endosymbiotic theory, as well as the concept of stealing of cell organelles called kleptoplasti ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Mesodinium Nuclear Code
The ''Mesodinium'' nuclear code (translation table 29) is a genetic code used by the nuclear genome of the ciliates ''Mesodinium'' and '' Myrionecta''. The code (29) : AAs = FFLLSSSSYYYYCC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG : Starts = --------------*--------------------M---------------------------- : Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG : Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG : Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U). Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S) ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Dinophysis
''Dinophysis'' is a genus of dinoflagellatesAlgaeBase''Dinophysis'' Ehrenberg, 1839/ref> common in tropical, temperate, coastal and oceanic waters.Hallegraeff, G.M., Lucas, I.A.N. 1988: The marine dinoflagellate genus Dinophysis (Dinophyceae): photosynthetic, neritic and non-photosynthetic, oceanic species. Phycologia, 27: 25–42. 10.2216/i0031-8884-27-1-25.1 It was first described in 1839 by Christian Gottfried Ehrenberg.Ehrenberg, C.G., 1839. Über jetzt wirklich noch zahlreich lebende Thier-Arten der Kreideformatien der Erde. Königlich Preussische Akademie der Wissenschaften zu Berlin, Bericht über die zur Bekanntmachung geeigneten Verhandlungen, 1839, p. 152-159. Über noch zahlreich jetzt lebende Thierarten der Kreidebildung, nach Vorträgen in der Akademie der Wissenschaften zu Berlin in den Jahren 1839 und 1840, L. Voss, LeipzigPDF p. 44ff ''Dinophysis'' are typically medium-sized cells (30-120 µm). The structural plan and plate tabulation are conserved ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Kleptoplasty
Kleptoplasty or kleptoplastidy is a symbiosis, symbiotic phenomenon whereby plastids, notably chloroplasts from algae, are sequestered by host organisms. The word is derived from ''Kleptes'' (κλέπτης) which is Greek language, Greek for thief. The alga is eaten normally and partially digested, leaving the plastid intact. The plastids are maintained within the host, temporarily continuing photosynthesis and benefiting the predator. The term was coined in 1990 to describe chloroplast symbiosis. Ciliates ''Mesodinium rubrum'' is a ciliate that steals chloroplasts from the cryptomonad ''Geminigera cryophila''. ''M. rubrum'' participates in additional endosymbiosis by transferring its plastids to its predators, the dinoflagellate planktons belonging to the genus ''Dinophysis''. Karyoklepty is a related process in which the nucleus of the prey cell is kept by the predator as well. This was first described in 2007 in ''M. rubrum''. Dinoflagellates The stability of transient ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Red Tide
A harmful algal bloom (HAB) (or excessive algae growth) is an algal bloom that causes negative impacts to other organisms by production of natural phycotoxin, algae-produced toxins, mechanical damage to other organisms, or by other means. HABs are sometimes defined as only those algal blooms that produce toxins, and sometimes as any algal bloom that can result in severely lower oxygen saturation, oxygen levels in natural waters, killing organisms in marine habitats, marine or fresh waters. Blooms can last from a few days to many months. After the bloom dies, the microorganism, microbes that decompose the dead algae use up more of the oxygen, generating a "dead zone (ecology), dead zone" which can cause fish kill, fish die-offs. When these zones cover a large area for an extended period of time, neither fish nor plants are able to survive. Harmful algal blooms in marine environments are often called "red tides". It is sometimes unclear what causes specific HABs as their occurrence ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Karyoklepty
Karyoklepty is a strategy for cellular evolution, whereby a predator Cell (biology), cell appropriates the Cell nucleus, nucleus of a cell from another organism to supplement its own biochemical capabilities. In the related process of kleptoplasty, the predator sequesters plastids (especially chloroplasts) from dietary algae. The chloroplasts can still photosynthesize, but do not last long after the prey's cells are metabolised. If the predator can also sequester cell nuclei from the prey to encode proteins for the plastids, it can sustain them. ''Karyoklepty'' is this sequestration of nuclei; even after sequestration, the nuclei are still capable of Transcription (genetics), transcription. Johnson et al. described and named karyoklepty in 2007 after observing it in the ciliate species ''Mesodinium rubrum''. ''Karyoklepty'' is a Greek compound of the words ''karydi'' ("kernel") and ''kleftis'' ("thief"). See also * Endosymbiont References Further reading * {{cite journal , l ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Ciliate
The ciliates are a group of alveolates characterized by the presence of hair-like organelles called cilia, which are identical in structure to flagellum, eukaryotic flagella, but are in general shorter and present in much larger numbers, with a different wikt:undulating, undulating pattern than flagella. Cilia occur in all members of the group (although the peculiar Suctoria only have them for part of their biological life cycle, life cycle) and are variously used in swimming, crawling, attachment, feeding, and sensation. Ciliates are an important group of protists, common almost anywhere there is water—in lakes, ponds, oceans, rivers, and soils. About 4,500 unique free-living species have been described, and the potential number of extant species is estimated at 27,000–40,000. Included in this number are many Ectosymbiosis, ectosymbiotic and endosymbiotic species, as well as some Obligate parasite, obligate and Facultative parasite, opportunistic parasites. Ciliate species r ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |