|
Mesodinium
Mesodinium is a genus of ciliates that are widely distributed and are abundant in marine and brackish waters. Currently, six marine species of ''Mesodinium'' have been described and grouped by nutritional mode: plastidic (''M. chamaeleon'', ''M. coatsi'', ''M. major'', and ''M. rubrum'') or heterotrophic (''M. pulex'' and ''M. pupula''). There is some debate as to whether the nutritional mode of plastidic ''Mesodinium ''species is phototrophic (permanent plastid) or mixotrophic. Among the plastidic species, wild ''M. major'' and ''M. rubrum'' populations possess red plastids belonging to genera ''Teleaulax'', ''Plagioselmis'', and ''Geminigera'', while wild ''M. chamaeleon'' and ''M. coatsi'' populations normally contain green plastids. The availability of suitable cryptophyte prey is important for bloom formation of plastidic ''Mesodinium'' species. The most common species, ''Mesodinium rubrum'', causes red tides in many coastal ecosystems. Although ''M. rubrum'' is known as a ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Mesodinium Chamaeleon
''Mesodinium chamaeleon'' is a ciliate of the genus ''Mesodinium''. It is known for being able to consume and maintain algae endosymbiotically for days before digesting the algae. It has the ability to eat red and green algae, and afterwards using the chlorophyll granules from the algae to generate energy, turning itself from being a heterotroph into an autotroph. The species was discovered in January 2012 outside the coast of Nivå, Denmark by professor Øjvind Moestrup. In contrast to certain other species of the genus, ''Mesodinium chamaeleon'' can be maintained in culture for short periods only. It captures and ingests flagellates including cryptomonads. The prey is ingested very rapidly into a food vacuole without the cryptomonad flagella being shed and the trichocysts being discharged. The individual food vacuoles subsequently serve as photosynthetic units, each containing the cryptomonad chloroplast, a nucleus, and some mitochondria. The ingested cells are eventually d ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Mesodinium Rubrum
''Mesodinium rubrum'' (or ''Myrionecta rubra'') is a species of ciliates. It constitutes a plankton community and is found throughout the year, most abundantly in spring and fall, in coastal areas. Although discovered in 1908, its scientific importance came into light in the late 1960s when it attracted scientists by the recurrent red colouration it caused by forming massive blooms, that cause red tides in the oceans. Unlike typical protozoans, ''M. rubrum'' can make its own nutrition by photosynthesis. The unusual autotrophic property was discovered in 2006 when genetic sequencing revealed that the photosynthesising organelles, plastids, were derived from the ciliate's principal food, the autotrophic algae called cryptomonads (or cryptophytes), which contain endosymbiont red algae whose internal chloroplasts (evolved via endosymbiosis with cyanobacteria) indirectly enable ''M. rubrum'' to photosynthesize using sunlight. The ciliate is thus both autotrophic and heterotrophic a ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Dinophysis
''Dinophysis'' is a genus of dinoflagellatesAlgaeBase''Dinophysis'' Ehrenberg, 1839/ref> common in tropical, temperate, coastal and oceanic waters.Hallegraeff, G.M., Lucas, I.A.N. 1988: The marine dinoflagellate genus Dinophysis (Dinophyceae): photosynthetic, neritic and non-photosynthetic, oceanic species. Phycologia, 27: 25–42. 10.2216/i0031-8884-27-1-25.1 It was first described in 1839 by Christian Gottfried Ehrenberg.Ehrenberg, C.G., 1839. Über jetzt wirklich noch zahlreich lebende Thier-Arten der Kreideformatien der Erde. Königlich Preussische Akademie der Wissenschaften zu Berlin, Bericht über die zur Bekanntmachung geeigneten Verhandlungen, 1839, p. 152-159. Über noch zahlreich jetzt lebende Thierarten der Kreidebildung, nach Vorträgen in der Akademie der Wissenschaften zu Berlin in den Jahren 1839 und 1840, L. Voss, LeipzigPDF p. 44ff ''Dinophysis'' are typically medium-sized cells (30-120 μm). The structural plan and plate tabulation are conserved ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Mesodinium Nuclear Code
The ''Mesodinium'' nuclear code (translation table 29) is a genetic code used by the nuclear genome of the ciliates ''Mesodinium'' and '' Myrionecta''. The code (29) : AAs = FFLLSSSSYYYYCC*WLLLAPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGG : Starts = --------------*--------------------M---------------------------- : Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGG : Base2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGG : Base3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U). Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threoni ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Kleptoplasty
Kleptoplasty or kleptoplastidy is a process in symbiosis, symbiotic relationships whereby plastids, notably chloroplasts from algae, are sequestered by the host. The word is derived from ''Kleptes'' (κλέπτης) which is Greek language, Greek for thief. The alga is eaten normally and partially digested, leaving the plastid intact. The plastids are maintained within the host, temporarily continuing photosynthesis and benefiting the host. Etymology The word kleptoplasty is derived from Ancient Greek (), meaning , and (), originally meaning formed or moulded, and used in biology to mean a plastid. Process Kleptoplasty is a process in symbiosis, symbiotic relationships whereby plastids, notably chloroplasts from algae, are sequestered by the host. The alga is eaten normally and partially digested, leaving the plastid intact. The plastids are maintained within the host, temporarily continuing photosynthesis and benefiting the host. The term was coined in 1990 to describe c ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Red Tide
A harmful algal bloom (HAB), or excessive algae growth, sometimes called a red tide in marine environments, is an algal bloom that causes negative impacts to other organisms by production of natural algae-produced toxins, water deoxygenation, mechanical damage to other organisms, or by other means. HABs are sometimes defined as only those algal blooms that produce toxins, and sometimes as any algal bloom that can result in severely lower oxygen levels in natural waters, killing organisms in marine or fresh waters. Blooms can last from a few days to many months. After the bloom dies, the microbes that decompose the dead algae use up more of the oxygen, generating a " dead zone" which can cause fish die-offs. When these zones cover a large area for an extended period of time, neither fish nor plants are able to survive. It is sometimes unclear what causes specific HABs as their occurrence in some locations appears to be entirely natural, while in others they appear to be a res ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
Karyoklepty
Karyoklepty ( ) is a strategy for cellular evolution, whereby a predator cell appropriates the nucleus of a cell from another organism to supplement its own biochemical capabilities. In the related process of kleptoplasty, the predator sequesters plastids (especially chloroplasts) from dietary algae. The chloroplasts can still photosynthesize, but do not last long after the prey's cells are metabolised. If the predator can also sequester cell nuclei from the prey to encode proteins for the plastids, it can sustain them. ''Karyoklepty'' is this sequestration of nuclei; even after sequestration, the nuclei are still capable of transcription. Johnson et al. described and named karyoklepty in 2007 after observing it in the ciliate species ''Mesodinium rubrum''. ''Karyoklepty'' is a Greek compound of the words ''karydi'' ("kernel") and ''kleftis'' ("thief"). See also * Endosymbiont References Further reading * {{cite journal , last1=Nowack , first1=Eva C. M. , last2=Melkonian , fi ... [...More Info...] [...Related Items...] OR: [Wikipedia] [Google] [Baidu] |
