![Toxin-antitoxin inheritance](https://upload.wikimedia.org/wikipedia/commons/7/74/Toxin-antitoxin_inheritance.png)
A toxin-antitoxin system is a set of two or more closely linked
gene
In biology, the word gene (from , ; "...Wilhelm Johannsen coined the word gene to describe the Mendelian units of heredity..." meaning ''generation'' or ''birth'' or ''gender'') can have several different meanings. The Mendelian gene is a ba ...
s that together encode both a "toxin" protein and a corresponding "antitoxin". Toxin-antitoxin systems are widely distributed in
prokaryote
A prokaryote () is a single-celled organism that lacks a nucleus and other membrane-bound organelles. The word ''prokaryote'' comes from the Greek πρό (, 'before') and κάρυον (, 'nut' or 'kernel').Campbell, N. "Biology:Concepts & Connec ...
s, and organisms often have them in multiple copies.
When these systems are contained on
plasmid
A plasmid is a small, extrachromosomal DNA molecule within a cell that is physically separated from chromosomal DNA and can replicate independently. They are most commonly found as small circular, double-stranded DNA molecules in bacteria; how ...
s – transferable genetic elements – they ensure that only the daughter cells that
inherit the plasmid survive after
cell division
Cell division is the process by which a parent cell (biology), cell divides into two daughter cells. Cell division usually occurs as part of a larger cell cycle in which the cell grows and replicates its chromosome(s) before dividing. In eukar ...
. If the plasmid is absent in a daughter cell, the unstable
antitoxin
An antitoxin is an antibody with the ability to neutralize a specific toxin. Antitoxins are produced by certain animals, plants, and bacteria in response to toxin exposure. Although they are most effective in neutralizing toxins, they can also ...
is degraded and the stable toxic protein kills the new cell; this is known as 'post-segregational killing'
(PSK).
Toxin-antitoxin systems are typically classified according to how the antitoxin neutralises the toxin. In a type I toxin-antitoxin system, the
translation
Translation is the communication of the Meaning (linguistic), meaning of a #Source and target languages, source-language text by means of an Dynamic and formal equivalence, equivalent #Source and target languages, target-language text. The ...
of
messenger RNA
In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of synthesizing a protein.
mRNA is created during the p ...
(mRNA) that encodes the toxin is inhibited by the binding of a small
non-coding RNA
A non-coding RNA (ncRNA) is a functional RNA molecule that is not Translation (genetics), translated into a protein. The DNA sequence from which a functional non-coding RNA is transcribed is often called an RNA gene. Abundant and functionally im ...
antitoxin that binds the toxin mRNA. The toxic protein in a type II system is inhibited post-translationally by the binding of an antitoxin
protein
Proteins are large biomolecules and macromolecules that comprise one or more long chains of amino acid residues. Proteins perform a vast array of functions within organisms, including catalysing metabolic reactions, DNA replication, respo ...
. Type III toxin-antitoxin systems consist of a small RNA that binds directly to the toxin protein and inhibits its activity.
There are also types IV-VI, which are less common. Toxin-antitoxin
gene
In biology, the word gene (from , ; "...Wilhelm Johannsen coined the word gene to describe the Mendelian units of heredity..." meaning ''generation'' or ''birth'' or ''gender'') can have several different meanings. The Mendelian gene is a ba ...
s are often inherited through
horizontal gene transfer
Horizontal gene transfer (HGT) or lateral gene transfer (LGT) is the movement of genetic material between Unicellular organism, unicellular and/or multicellular organisms other than by the ("vertical") transmission of DNA from parent to offsprin ...
and are associated with
pathogenic bacteria
Pathogenic bacteria are bacteria that can cause disease. This article focuses on the bacteria that are pathogenic to humans. Most species of bacteria are harmless and are often Probiotic, beneficial but others can cause infectious diseases. The n ...
, having been found on plasmids conferring
antibiotic resistance
Antimicrobial resistance (AMR) occurs when microbes evolve mechanisms that protect them from the effects of antimicrobials. All classes of microbes can evolve resistance. Fungi evolve antifungal resistance. Viruses evolve antiviral resistance. ...
and
virulence
Virulence is a pathogen's or microorganism's ability to cause damage to a host.
In most, especially in animal systems, virulence refers to the degree of damage caused by a microbe to its host. The pathogenicity of an organism—its ability to ca ...
.
Chromosomal
A chromosome is a long DNA molecule with part or all of the genetic material of an organism. In most chromosomes the very long thin DNA fibers are coated with packaging proteins; in eukaryotic cells the most important of these proteins are ...
toxin-antitoxin systems also exist, some of which are thought to perform cell functions such as responding to
stresses, causing
cell cycle
The cell cycle, or cell-division cycle, is the series of events that take place in a cell that cause it to divide into two daughter cells. These events include the duplication of its DNA (DNA replication) and some of its organelles, and subs ...
arrest and bringing about
programmed cell death
Programmed cell death (PCD; sometimes referred to as cellular suicide) is the death of a cell as a result of events inside of a cell, such as apoptosis or autophagy. PCD is carried out in a biological process, which usually confers advantage durin ...
.
In
evolution
Evolution is change in the heritable characteristics of biological populations over successive generations. These characteristics are the expressions of genes, which are passed on from parent to offspring during reproduction. Variation ...
ary terms, toxin-antitoxin systems can be considered
selfish DNA
Selfish genetic elements (historically also referred to as selfish genes, ultra-selfish genes, selfish DNA, parasitic DNA and genomic outlaws) are genetic segments that can enhance their own transmission at the expense of other genes in the genome, ...
in that the purpose of the systems are to replicate, regardless of whether they benefit the host organism or not. Some have proposed adaptive theories to explain the evolution of toxin-antitoxin systems; for example, chromosomal toxin-antitoxin systems could have evolved to prevent the inheritance of large
deletions of the host genome.
Toxin-antitoxin systems have several
biotechnological
Biotechnology is the integration of natural sciences and engineering sciences in order to achieve the application of organisms, cells, parts thereof and molecular analogues for products and services. The term ''biotechnology'' was first used ...
applications, such as maintaining plasmids in
cell lines
An immortalised cell line is a population of cells from a multicellular organism which would normally not proliferate indefinitely but, due to mutation, have evaded normal cellular senescence and instead can keep undergoing division. The cells ...
, targets for
antibiotic
An antibiotic is a type of antimicrobial substance active against bacteria. It is the most important type of antibacterial agent for fighting bacterial infections, and antibiotic medications are widely used in the treatment and prevention of ...
s, and as positive selection vectors.
Biological functions
Stabilization and fitness of mobile DNA
As stated above, toxin-antitoxin systems are well characterized as plasmid addiction modules. It was also proposed that toxin-antitoxin systems have
evolved
Evolution is change in the heritable characteristics of biological populations over successive generations. These characteristics are the expressions of genes, which are passed on from parent to offspring during reproduction. Variation ...
as plasmid exclusion modules. A cell that would carry two plasmids from the same incompatibility group will eventually generate two daughters cells carrying either plasmid. Should one of these plasmids encode for a TA system, its "displacement" by another TA-free plasmid system will prevent its inheritance and thus induce post-segregational killing. This theory was corroborated through
computer modelling
Computer simulation is the process of mathematical modelling, performed on a computer, which is designed to predict the behaviour of, or the outcome of, a real-world or physical system. The reliability of some mathematical models can be det ...
.
Toxin-antitoxin systems can also be found on other
mobile genetic elements
Mobile genetic elements (MGEs) sometimes called selfish genetic elements are a type of genetic material that can move around within a genome, or that can be transferred from one species or replicon to another. MGEs are found in all organisms. In ...
such as conjugative
transposons
A transposable element (TE, transposon, or jumping gene) is a nucleic acid sequence in DNA that can change its position within a genome, sometimes creating or reversing mutations and altering the cell's genetic identity and genome size. Transpo ...
and
temperate
In geography, the temperate climates of Earth occur in the middle latitudes (23.5° to 66.5° N/S of Equator), which span between the tropics and the polar regions of Earth. These zones generally have wider temperature ranges throughout t ...
bacteriophage
A bacteriophage (), also known informally as a ''phage'' (), is a duplodnaviria virus that infects and replicates within bacteria and archaea. The term was derived from "bacteria" and the Greek φαγεῖν ('), meaning "to devour". Bacteri ...
s and could be implicated in the maintenance and competition of these elements.
Genome stabilization
![S meliloti strain 1021 TA map](https://upload.wikimedia.org/wikipedia/commons/b/b5/S_meliloti_strain_1021_TA_map.png)
Toxin-antitoxin systems could prevent harmful large
deletions in a bacterial
genome
In the fields of molecular biology and genetics, a genome is all the genetic information of an organism. It consists of nucleotide sequences of DNA (or RNA in RNA viruses). The nuclear genome includes protein-coding genes and non-coding ge ...
, though arguably deletions of large coding regions are fatal to a daughter cell regardless.
In ''Vibrio cholerae'', multiple type II toxin-antitoxin systems located in a
super-integron were shown to prevent the loss of gene cassettes.
Altruistic cell death
''mazEF'', a toxin-antitoxin locus found in ''E. coli'' and other bacteria, was proposed to induce programmed cell death in response to
starvation
Starvation is a severe deficiency in caloric energy intake, below the level needed to maintain an organism's life. It is the most extreme form of malnutrition. In humans, prolonged starvation can cause permanent organ damage and eventually, dea ...
, specifically a lack of
amino acid
Amino acids are organic compounds that contain both amino and carboxylic acid functional groups. Although hundreds of amino acids exist in nature, by far the most important are the alpha-amino acids, which comprise proteins. Only 22 alpha am ...
s. This would release the cell's contents for absorption by neighbouring cells, potentially preventing the death of close relatives, and thereby increasing the
inclusive fitness
In evolutionary biology, inclusive fitness is one of two metrics of evolutionary success as defined by W. D. Hamilton in 1964:
* Personal fitness is the number of offspring that an individual begets (regardless of who rescues/rears/supports them ...
of the cell that perished. This would be an example of
altruism
Altruism is the principle and moral practice of concern for the welfare and/or happiness of other human beings or animals, resulting in a quality of life both material and spiritual. It is a traditional virtue in many cultures and a core as ...
and how
bacterial colonies could resemble
multicellular organism
A multicellular organism is an organism that consists of more than one cell, in contrast to unicellular organism.
All species of animals, land plants and most fungi are multicellular, as are many algae, whereas a few organisms are partially uni- ...
s.
However, the "''mazEF''-mediated PCD" has largely been refuted by several studies.
Stress tolerance
Another theory states that chromosomal toxin-antitoxin systems are designed to be
bacteriostatic
A bacteriostatic agent or bacteriostat, abbreviated Bstatic, is a biological or chemical agent that stops bacteria from reproducing, while not necessarily killing them otherwise. Depending on their application, bacteriostatic antibiotics, disinfect ...
rather than
bactericidal
A bactericide or bacteriocide, sometimes abbreviated Bcidal, is a substance which kills bacteria. Bactericides are disinfectants, antiseptics, or antibiotics.
However, material surfaces can also have bactericidal properties based solely on their ...
.
RelE, for example, is a global inhibitor of translation, is induced during
nutrient
A nutrient is a substance used by an organism to survive, grow, and reproduce. The requirement for dietary nutrient intake applies to animals, plants, fungi, and protists. Nutrients can be incorporated into cells for metabolic purposes or excret ...
stress. By shutting down translation under stress, it could reduce the chance of starvation by lowering the cell's nutrient requirements.
However, it was shown that several toxin-antitoxin systems, including ''relBE'', do not give any competitive advantage under any stress condition.
Anti-addiction
It has been proposed that chromosomal homologues of plasmid toxin-antitoxin systems may serve as anti-
addiction modules, which would allow progeny to lose a plasmid without suffering the effects of the toxin it encodes.
For example, a chromosomal copy of ''the ccdA'' antitoxin encoded in the chromosome of ''
Erwinia chrysanthemi
''Dickeya dadantii'' is a gram-negative bacillus that belongs to the family Pectobacteriaceae. It was formerly known as ''Erwinia chrysanthemi'' but was reassigned as ''Dickeya dadantii'' in 2005. Members of this family are facultative anaerobes ...
'' is able to neutralize the ''ccdB'' toxin encoded on the
F plasmid
F, or f, is the sixth letter in the Latin alphabet, used in the modern English alphabet, the alphabets of other western European languages and others worldwide. Its name in English is ''ef'' (pronounced ), and the plural is ''efs''.
Hist ...
and thus, prevent toxin activation when such a plasmid is lost. Similarly, the ''ataR'' antitoxin encoded on the chromosome of
''E. coli'' O157:H7 is able neutralize the ''ataT
P'' toxin encoded on plasmids found in other
enterohemorragic ''E. coli''.
Phage protection
Type III toxin-antitoxin (AbiQ) systems have been shown to protect bacteria from
bacteriophage
A bacteriophage (), also known informally as a ''phage'' (), is a duplodnaviria virus that infects and replicates within bacteria and archaea. The term was derived from "bacteria" and the Greek φαγεῖν ('), meaning "to devour". Bacteri ...
s altruistically.
During an infection, bacteriophages hijack transcription and translation, which could prevent antitoxin replenishment and release toxin, triggering what is called an "abortive infection".
Similar protective effects have been observed with type I,
type II,
and type IV (AbiE) toxin-antitoxin systems.
Abortive initiation (Abi) can also happen without toxin-antitoxin systems, and many Abi proteins of other types exist. This mechanism serves to halt the replication of phages, protecting the overall population from harm.
Antimicrobial persistence
When bacteria are challenged with antibiotics, a small and distinct subpopulation of cells is able to withstand the treatment by a phenomenon dubbed as "persistence" (not to be confused with
resistance).
Due to their bacteriostatic properties, type II toxin-antitoxin systems have previously been thought to be responsible for persistence, by switching a fraction of the bacterial population to a dormant state. However, this hypothesis has been widely invalidated.
Selfish DNA
Toxin-antitoxin systems have been used as examples of selfish DNA as part of the
gene centered view of evolution. It has been theorised that toxin-antitoxin loci serve only to maintain their own DNA, at the expense of the host organism.
Thus, chromosomal toxin-antitoxin systems would serve no purpose and could be treated as "junk DNA". For example, the ''ccdAB'' system encoded in the chromosome of
''E. coli'' O157:H7 has been shown to be under negative selection, albeit at a slow rate due to its addictive properties.
System types
Type I
![Hok sok system R1 plasmid present](https://upload.wikimedia.org/wikipedia/commons/0/0f/Hok_sok_system_R1_plasmid_present.gif)
Type I toxin-antitoxin systems rely on the
base-pairing
A base pair (bp) is a fundamental unit of double-stranded nucleic acids consisting of two nucleobases bound to each other by hydrogen bonds. They form the building blocks of the DNA double helix and contribute to the folded structure of both DNA ...
of complementary antitoxin
RNA
Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding, decoding, regulation and expression of genes. RNA and deoxyribonucleic acid ( DNA) are nucleic acids. Along with lipids, proteins, and carbohydra ...
with the toxin
mRNA
In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of Protein biosynthesis, synthesizing a protein.
mRNA is ...
. Translation of the mRNA is then inhibited either by degradation via
RNase III
Ribonuclease III (RNase III or RNase C)(BREND3.1.26.3 is a type of ribonuclease that recognizes dsRNA and cleaves it at specific targeted locations to transform them into mature RNAs. These enzymes are a group of endoribonucleases that are chara ...
or by occluding the
Shine-Dalgarno sequence or
ribosome binding site A ribosome binding site, or ribosomal binding site (RBS), is a sequence of nucleotides upstream of the start codon of an mRNA transcript that is responsible for the recruitment of a ribosome during the initiation of translation. Mostly, RBS refers t ...
of the toxin mRNA. Often the toxin and antitoxin are encoded on opposite strands of DNA. The
5' or
3' overlapping region between the two genes is the area involved in
complementary
A complement is something that completes something else.
Complement may refer specifically to:
The arts
* Complement (music), an interval that, when added to another, spans an octave
** Aggregate complementation, the separation of pitch-class ...
base-pairing, usually with between 19–23 contiguous base pairs.
Toxins of type I systems are small,
hydrophobic
In chemistry, hydrophobicity is the physical property of a molecule that is seemingly repelled from a mass of water (known as a hydrophobe). In contrast, hydrophiles are attracted to water.
Hydrophobic molecules tend to be nonpolar and, th ...
proteins that confer toxicity by damaging
cell membrane
The cell membrane (also known as the plasma membrane (PM) or cytoplasmic membrane, and historically referred to as the plasmalemma) is a biological membrane that separates and protects the interior of all cells from the outside environment ( ...
s.
Few intracellular targets of type I toxins have been identified, possibly due to the difficult nature of analysing proteins that are poisonous to their bacterial hosts.
Also, the detection of small proteins has been challenging due to technical issues, a problem that remains to be solved with large-scale analysis.
Type I systems sometimes include a third component. In the case of the well-characterised
''hok''/''sok'' system, in addition to the ''hok'' toxin and ''sok'' antitoxin, there is a third gene, called ''mok''. This
open reading frame
In molecular biology, open reading frames (ORFs) are defined as spans of DNA sequence between the start and stop codons. Usually, this is considered within a studied region of a prokaryotic DNA sequence, where only one of the six possible readin ...
almost entirely overlaps that of the toxin, and the translation of the toxin is dependent on the translation of this third component.
Thus the binding of antitoxin to toxin is sometimes a simplification, and the antitoxin in fact binds a third RNA, which then affects toxin
translation
Translation is the communication of the Meaning (linguistic), meaning of a #Source and target languages, source-language text by means of an Dynamic and formal equivalence, equivalent #Source and target languages, target-language text. The ...
.
Example systems
Type II
![Typical TA sys](https://upload.wikimedia.org/wikipedia/commons/1/1c/Typical_TA_sys.png)
Type II toxin-antitoxin systems are generally better-understood than type I.
In this system a
labile
Lability refers to something that is constantly undergoing change or is likely to undergo change.
Biochemistry
In reference to biochemistry, this is an important concept as far as kinetics is concerned in metalloproteins. This can allow for th ...
proteic antitoxin tightly binds and inhibits the activity of a stable toxin.
The largest family of type II toxin-antitoxin systems is ''
vapBC'', which has been found through
bioinformatics
Bioinformatics () is an interdisciplinary field that develops methods and software tools for understanding biological data, in particular when the data sets are large and complex. As an interdisciplinary field of science, bioinformatics combi ...
searches to represent between 37 and 42% of all predicted type II loci.
Type II systems are organised in
operon
In genetics, an operon is a functioning unit of DNA containing a cluster of genes under the control of a single promoter. The genes are transcribed together into an mRNA strand and either translated together in the cytoplasm, or undergo splic ...
s with the antitoxin protein typically being located
upstream
Upstream may refer to:
* Upstream (bioprocess)
* ''Upstream'' (film), a 1927 film by John Ford
* Upstream (networking)
* ''Upstream'' (newspaper), a newspaper covering the oil and gas industry
* Upstream (petroleum industry)
* Upstream (software ...
of the toxin, which helps to prevent expression of the toxin without the antitoxin. The proteins are typically around 100
amino acid
Amino acids are organic compounds that contain both amino and carboxylic acid functional groups. Although hundreds of amino acids exist in nature, by far the most important are the alpha-amino acids, which comprise proteins. Only 22 alpha am ...
s in length,
and exhibit toxicity in a number of ways:
CcdB
Christian Commission for Development in Bangladesh (CCDB) founded in 1972, immediately after the Bangladesh Liberation War, by the World Council of Churches (WCC) to succeed the Bangladesh Ecumenical Relief and Rehabilitation Services (BERRS). Th ...
, for example, affects
DNA replication
In molecular biology, DNA replication is the biological process of producing two identical replicas of DNA from one original DNA molecule. DNA replication occurs in all living organisms acting as the most essential part for biological inheritanc ...
by poisoning
DNA gyrase
DNA gyrase, or simply gyrase, is an enzyme
Enzymes () are proteins that act as biological catalysts by accelerating chemical reactions. The molecules upon which enzymes may act are called substrates, and the enzyme converts the substrat ...
whereas toxins from the MazF family are endoribonucleases that cleave cellular mRNAs, tRNAs or rRNAs at specific
sequence motif
In biology, a sequence motif is a nucleotide or amino-acid sequence pattern that is widespread and usually assumed to be related to biological function of the macromolecule. For example, an ''N''-glycosylation site motif can be defined as ''As ...
s. The most common toxic activity is the protein acting as an
endonuclease
Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain. Some, such as deoxyribonuclease I, cut DNA relatively nonspecifically (without regard to sequence), while many, typically called restriction endonucleases ...
, also known as an
interferase.
One of the key features of the TAs is the autoregulation. The antitoxin and toxin protein complex bind to the operator that is present upstream of the TA genes. This results in repression of the TA operon. The key to the regulation are (i) the differential translation of the TA proteins and (ii) differential proteolysis of the TA proteins. As explained by the "Translation-reponsive model", the degree of expression is inversely proportional to the concentration of the repressive TA complex. The TA complex concentration is directly proportional to the global translation rate. The higher the rate of translation more TA complex and less transcription of TA mRNA. Lower the rate of translation, lesser the TA complex and higher the expression. Hence, the transcriptional expression of TA operon is inversely proportional to translation rate.
A third protein can sometimes be involved in type II toxin-antitoxin systems. in the case of the ω-ε-ζ (omega-epsilon-zeta) system, the omega protein is a
DNA binding protein
DNA-binding proteins are proteins that have DNA-binding domains and thus have a specific or general affinity for single- or double-stranded DNA. Sequence-specific DNA-binding proteins generally interact with the major groove of B-DNA, becaus ...
that negatively regulates the transcription of the whole system.
Similarly, the ''paaR2'' protein regulates the expression of the ''paaR2-paaA2-parE2'' toxin-antitoxin system. Other toxin-antitoxin systems can be found with a
chaperone as a third component. This chaperone is essential for proper
folding
Fold, folding or foldable may refer to:
Arts, entertainment, and media
* ''Fold'' (album), the debut release by Australian rock band Epicure
* Fold (poker), in the game of poker, to discard one's hand and forfeit interest in the current pot
*Abov ...
of the antitoxin, thus making the antitoxin addicted to its cognate chaperone.
Example systems
Type III
Type III toxin-antitoxin systems rely on direct interaction between a toxic protein and an RNA antitoxin. The toxic effects of the protein are neutralised by the RNA gene.
One example is the ToxIN system from the bacterial plant pathogen ''
Erwinia carotovora
''Pectobacterium carotovorum'' is a bacterium of the family Pectobacteriaceae; it used to be a member of the genus ''Erwinia''.
The species is a plant pathogen with a diverse host range, including many agriculturally and scientifically import ...
''. The toxic ToxN protein is approximately 170 amino acids long and has been shown to be toxic to ''
E. coli''. The toxic activity of ToxN is inhibited by ToxI RNA, an RNA with 5.5 direct
repeats of a 36 nucleotide motif (AGGTGATTTGCTACCTTTAAGTGCAGCTAGAAATTC).
Crystallographic analysis of ToxIN has found that ToxN inhibition requires the formation of a trimeric ToxIN complex, whereby three ToxI monomers bind three ToxN monomers; the complex is held together by extensive protein-RNA interactions.
Type IV
Type IV toxin-antitoxin systems are similar to type II systems, because they consist of two proteins. Unlike type II systems, the antitoxin in type IV toxin-antitoxin systems counteracts the activity of the toxin, and the two proteins do not necessarily interact directly. DarTG is a type IV toxin-antitoxin system where the toxin, DarT, modifies DNA by adding ADP-ribose to thymidine bases, and the antitoxin, DarG, removes the toxic modification.
Type V
''ghoST'' is a type V toxin-antitoxin system, in which the antitoxin (GhoS) cleaves the ''ghoT'' mRNA. This system is regulated by a type II system, ''mqsRA''.
Type VI
''socAB'' is a type VI toxin-antitoxin system that was discovered in ''
Caulobacter crescentus
''Caulobacter crescentus'' is a Gram-negative, oligotrophic bacterium widely distributed in fresh water lakes and streams. The taxon is more properly known as ''Caulobacter vibrioides'' (Henrici and Johnson 1935).
''C. crescentus'' is an importa ...
''. The antitoxin, SocA, promotes degradation of the toxin, SocB, by the
protease
A protease (also called a peptidase, proteinase, or proteolytic enzyme) is an enzyme that catalyzes (increases reaction rate or "speeds up") proteolysis, breaking down proteins into smaller polypeptides or single amino acids, and spurring the ...
ClpXP.
Type VII
Type VII has been proposed to include systems ''hha/tomB'', ''tglT/takA'' and ''hepT/mntA'', all of which neutralise toxin activity by post-translational chemical modification of amino acid residues.
Biotechnological applications
The
biotechnological applications of toxin-antitoxin systems have begun to be realised by several biotechnology organisations.
A primary usage is in maintaining plasmids in a large bacterial
cell culture
Cell culture or tissue culture is the process by which cells are grown under controlled conditions, generally outside of their natural environment. The term "tissue culture" was coined by American pathologist Montrose Thomas Burrows. This te ...
. In an experiment examining the effectiveness of the ''hok''/''sok'' locus, it was found that segregational stability of an
inserted plasmid expressing
beta-galactosidase
β-Galactosidase (EC 3.2.1.23, lactase, beta-gal or β-gal; systematic name β-D-galactoside galactohydrolase), is a glycoside hydrolase enzyme that catalyzes hydrolysis of terminal non-reducing β-D-galactose residues in β-D-galactosides.
β- ...
was increased by between 8 and 22 times compared to a
control
Control may refer to:
Basic meanings Economics and business
* Control (management), an element of management
* Control, an element of management accounting
* Comptroller (or controller), a senior financial officer in an organization
* Controllin ...
culture lacking a toxin-antitoxin system.
In large-scale
microorganism
A microorganism, or microbe,, ''mikros'', "small") and ''organism'' from the el, ὀργανισμός, ''organismós'', "organism"). It is usually written as a single word but is sometimes hyphenated (''micro-organism''), especially in olde ...
processes such as
fermentation
Fermentation is a metabolic process that produces chemical changes in organic substrates through the action of enzymes. In biochemistry, it is narrowly defined as the extraction of energy from carbohydrates in the absence of oxygen. In food ...
, progeny cells lacking the plasmid insert often have a higher
fitness than those who inherit the plasmid and can outcompete the desirable microorganisms. A toxin-antitoxin system maintains the plasmid thereby maintaining the efficiency of the industrial process.
Additionally, toxin-antitoxin systems may be a future target for
antibiotic
An antibiotic is a type of antimicrobial substance active against bacteria. It is the most important type of antibacterial agent for fighting bacterial infections, and antibiotic medications are widely used in the treatment and prevention of ...
s. Inducing suicide modules against pathogens could help combat the growing problem of
multi-drug resistance.
Ensuring a plasmid accepts an insert is a common problem of DNA
cloning
Cloning is the process of producing individual organisms with identical or virtually identical DNA, either by natural or artificial means. In nature, some organisms produce clones through asexual reproduction. In the field of biotechnology, cl ...
. Toxin-antitoxin systems can be used to positively select for only those cells that have taken up a plasmid containing the inserted gene of interest, screening out those that lack the inserted gene. An example of this application comes from the ''ccdB''-encoded toxin, which has been incorporated into
plasmid vectors.
The gene of interest is then targeted to recombine into the ''ccdB'' locus, inactivating the transcription of the toxic protein. Thus, cells containing the plasmid but not the insert perish due to the toxic effects of CcdB protein, and only those that incorporate the insert survive.
Another example application involves both the CcdB toxin and CcdA antitoxin. CcdB is found in recombinant bacterial genomes and an inactivated version of CcdA is inserted into a
linearised plasmid vector. A short extra sequence is added to the gene of interest that activates the antitoxin when the insertion occurs. This method ensures
orientation-specific gene insertion.
Genetically modified organism
A genetically modified organism (GMO) is any organism whose genetic material has been altered using genetic engineering techniques. The exact definition of a genetically modified organism and what constitutes genetic engineering varies, with ...
s must be contained in a pre-defined area during
research
Research is "creativity, creative and systematic work undertaken to increase the stock of knowledge". It involves the collection, organization and analysis of evidence to increase understanding of a topic, characterized by a particular att ...
.
Toxin-antitoxin systems can cause cell
suicide
Suicide is the act of intentionally causing one's own death. Mental disorders (including depression, bipolar disorder, schizophrenia, personality disorders, anxiety disorders), physical disorders (such as chronic fatigue syndrome), and s ...
in certain conditions, such as a lack of a lab-specific
growth medium
A growth medium or culture medium is a solid, liquid, or semi-solid designed to support the growth of a population of microorganisms or cells via the process of cell proliferation or small plants like the moss ''Physcomitrella patens''. Differen ...
they would not encounter outside of the controlled
laboratory
A laboratory (; ; colloquially lab) is a facility that provides controlled conditions in which scientific or technological research, experiments, and measurement may be performed. Laboratory services are provided in a variety of settings: physicia ...
set-up.
See also
*
Toxin-antitoxin database
References
External links
RASTA– Rapid Automated Scan for Toxins and Antitoxins in Bacteria
{{Good article
Plasmids
Non-coding RNA
Toxins
RNA-binding proteins