Nucleotide
Nucleotides are organic molecules consisting of a nucleoside and a phosphate. They serve as monomeric units of the nucleic acid polymers – deoxyribonucleic acid (DNA) and ribonucleic acid (RNA), both of which are essential biomolecules wi ...
change
!Position (
base pair
A base pair (bp) is a fundamental unit of double-stranded nucleic acids consisting of two nucleobases bound to each other by hydrogen bonds. They form the building blocks of the DNA double helix and contribute to the folded structure of both DNA ...
)
!Total size (
base pair
A base pair (bp) is a fundamental unit of double-stranded nucleic acids consisting of two nucleobases bound to each other by hydrogen bonds. They form the building blocks of the DNA double helix and contribute to the folded structure of both DNA ...
M343
Haplogroup R1b (R-M343), previously known as Hg1 and Eu18, is a human Y-chromosome haplogroup.
It is the most frequently occurring paternal lineage in Western Europe, as well as some parts of Russia (e.g. the Bashkirs) and pockets of Central A ...
, C to A
, 402
, 424
,
,
, -
!M347
,
,
,
,
,
, -
!M349
, G to T
, 209
, 493
,
,
, -
!M356
,
,
,
,
,
, -
!M359
, T to C
, 122
, 447
,
,
, -
!M365
, A to G
, 246
, 274
,
,
, -
!M367
, A to G
, 196
, 274
,
,
, -
!M368
, A to C
, 200
, 274
,
,
, -
!M369
, G to C
, 45
, 274
,
,
, -
!M370
, C to G
, 166
, 274
,
, {{DNA sequence, tgtatctttagttgagatgg
, -
!M405
,
,
,
,
,
See also
*
Single-nucleotide polymorphism
In genetics, a single-nucleotide polymorphism (SNP ; plural SNPs ) is a germline substitution of a single nucleotide at a specific position in the genome. Although certain definitions require the substitution to be present in a sufficiently lar ...
*
Unique-event polymorphism
In genetic genealogy, a unique-event polymorphism (UEP) is a genetic marker that corresponds to a mutation that is likely to occur so infrequently that it is believed overwhelmingly probable that all the individuals who share the marker, worldwid ...
*
Human Y-chromosome DNA haplogroup
In human genetics, a human Y-chromosome DNA haplogroup is a haplogroup defined by mutations in the non- recombining portions of DNA from the male-specific Y chromosome (called Y-DNA). Many people within a haplogroup share similar numbers of sh ...
s
*
List of Y-STR markers
The following list of Y-STR markers are commonly used in forensic and genealogical DNA testing.
DYS454 is the least diverse, and multi-copy marker DYS464 is the most diverse Y-STR marker.
The location on the Y-chromosome of numbered Y-STR mark ...
Y DNA
The Y chromosome is one of two sex chromosomes (allosomes) in therian mammals, including humans, and many other animals. The other is the X chromosome. Y is normally the sex-determining chromosome in many species, since it is the presence or abs ...