Subgenomic

mRNA In molecular biology, messenger ribonucleic acid (mRNA) is a single-stranded molecule of RNA that corresponds to the genetic sequence of a gene, and is read by a ribosome in the process of Protein biosynthesis, synthesizing a protein. mRNA is ...

s are essentially smaller sections of the original transcribed

template strand Transcription is the process of copying a segment of DNA into RNA. The segments of DNA transcribed into RNA molecules that can encode proteins are said to produce messenger RNA (mRNA). Other segments of DNA are copied into RNA molecules called ...

3' to 5' DNA or RNA

During

transcription Transcription refers to the process of converting sounds (voice, music etc.) into letters or musical notes, or producing a copy of something in another medium, including: Genetics * Transcription (biology), the copying of DNA into RNA, the fir ...

, the original template strand is usually read from the 3' to the 5' end from beginning to end. Subgenomic mRNAs are created when transcription begins at the 3' end of the template strand (or 5' of the to-be-newly synthesized template) and begins to copy towards the 5' end of the template strand before "jumping" to the end of the template and copying the last nucleotides of the 5' end of the template, (finishing the 3' tail for the newly created strand). As a result, the translated strand will have a similar 5' end to varying degrees with the original template (depending on which part of the template the transcription jumped over) and a similar 3' end to the template.

5' to 3' (positive sense) viral RNA

Positive-sense (5' to 3') viral RNA which may be directly translated into the desired viral proteins, undergoes a similar process as described in 3' to 5'. Portions of the viral RNA may be skipped during translation.

Result

The result is that many different

proteins Proteins are large biomolecules and macromolecules that comprise one or more long chains of amino acid residues. Proteins perform a vast array of functions within organisms, including catalysing metabolic reactions, DNA replication, respo ...

can be created from the same mRNA strand, with similar 5' ends (to varying degrees) and same 3' ends. Or, different proteins can be created with positive sense viral RNA. The 5' section on the newly created strand matches that of the template strand, and this section on the template strand is referred to as the "nested set".

3'                                                          5'
 GCCGCCCCGTATCGATCGTAGCGCACGTTATATATACGTTATTTCTGCGCGGAAAAAAAAA - Original template Strand
 
5'                                                          3'
 GCCGCCCCGTATCGATCGTAGCGCACGTTATATATAC---------------AAAAAAAAA      , 
 GCCGCCCCGTATCGATCGTAGCGCAC--------------------------AAAAAAAAA      ,  = Subgenomic mRNA. 
 GCCGCCCCGTAT----------------------------------------AAAAAAAAA      , 
 
 GCCGCCCCGTAT = Nested Set  - indicates jumps.

Examples

This complex method of transcription is generally restricted to

virus A virus is a submicroscopic infectious agent that replicates only inside the living cells of an organism. Viruses infect all life forms, from animals and plants to microorganisms, including bacteria and archaea. Since Dmitri Ivanovsky's 1 ...

es, especially those of the single-stranded, positive-sense

RNA Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding, decoding, regulation and expression of genes. RNA and deoxyribonucleic acid ( DNA) are nucleic acids. Along with lipids, proteins, and carbohydra ...

or Class IV viruses using the

Baltimore Classification System Baltimore classification is a system used to classify viruses based on their manner of messenger RNA (mRNA) synthesis. By organizing viruses based on their manner of mRNA production, it is possible to study viruses that behave similarly as a di ...

, e.g. viruses of the order

Nidovirales ''Nidovirales'' is an order of enveloped, positive-strand RNA viruses which infect vertebrates and invertebrates. Host organisms include mammals, birds, reptiles, amphibians, fish, arthropods, molluscs, and helminths. The order includes the fami ...

. It is primarily used for compacting more genetic information into a shorter amount of genetic material.

Literature

{{Nucleic acids RNA