Haplogroup I-M253, also known as I1, is a
Y chromosome
The Y chromosome is one of two sex chromosomes (allosomes) in therian mammals, including humans, and many other animals. The other is the X chromosome. Y is normally the sex-determining chromosome in many species, since it is the presence or abs ...
haplogroup
A haplotype is a group of alleles in an organism that are inherited together from a single parent, and a haplogroup (haploid from the el, ἁπλοῦς, ''haploûs'', "onefold, simple" and en, group) is a group of similar haplotypes that share ...
. The genetic markers confirmed as identifying I-M253 are the
SNPs
In genetics, a single-nucleotide polymorphism (SNP ; plural SNPs ) is a germline substitution of a single nucleotide at a specific position in the genome. Although certain definitions require the substitution to be present in a sufficiently larg ...
M253,M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187.
It is a primary branch of
Haplogroup I-M170
Haplogroup I (M170) is a Y-chromosome DNA haplogroup. It is a subgroup of haplogroup IJ, which itself is a derivative of the haplogroup IJK. Subclades I1 and I2 can be found in most present-day European populations, with peaks in some North ...
(I*).
Haplogroup I1 is believed to have been present among
Upper Paleolithic European hunter-gatherers as a minor lineage but due to its near-total absence in pre-
Neolithic
The Neolithic period, or New Stone Age, is an Old World archaeological period and the final division of the Stone Age. It saw the Neolithic Revolution, a wide-ranging set of developments that appear to have arisen independently in several pa ...
DNA samples it cannot have been very widespread. Neolithic I1 samples are very sparse as well, suggesting a rapid dispersion connected to a founder effect in the
Nordic Bronze Age
The Nordic Bronze Age (also Northern Bronze Age, or Scandinavian Bronze Age) is a period of Scandinavian prehistory from c. 2000/1750–500 BC.
The Nordic Bronze Age culture emerged about 1750 BC as a continuation of the Battle Axe culture (th ...
. Today it reaches its peak frequencies in
Sweden
Sweden, formally the Kingdom of Sweden,The United Nations Group of Experts on Geographical Names states that the country's formal name is the Kingdom of SwedenUNGEGN World Geographical Names, Sweden./ref> is a Nordic countries, Nordic c ...
(52 percent of males in
Västra Götaland County
Västra Götaland County ( sv, Västra Götalands län) is a county or '' län'' on the western coast of Sweden.
The county is the second most populous of Sweden's counties and it comprises 49 municipalities (''kommuner''). Its population of 1 ...
) and western
Finland
Finland ( fi, Suomi ; sv, Finland ), officially the Republic of Finland (; ), is a Nordic country in Northern Europe. It shares land borders with Sweden to the northwest, Norway to the north, and Russia to the east, with the Gulf of Bot ...
(more than 50 percent in
Satakunta
Satakunta (in both Finnish and Swedish, ) is a region ( / ) of Finland, part of the former Western Finland Province. It borders the regions of Southwest Finland, Pirkanmaa, South Ostrobothnia and Ostrobothnia. The capital city of the region ...
province).
In terms of national averages, I-M253 is found in 38-39% of
Swedish
Swedish or ' may refer to:
Anything from or related to Sweden, a country in Northern Europe. Or, specifically:
* Swedish language, a North Germanic language spoken primarily in Sweden and Finland
** Swedish alphabet, the official alphabet used by ...
males,
37% of
Norwegian
Norwegian, Norwayan, or Norsk may refer to:
*Something of, from, or related to Norway, a country in northwestern Europe
* Norwegians, both a nation and an ethnic group native to Norway
* Demographics of Norway
*The Norwegian language, including ...
males, 34.8% of
Danish males,
34.5% of
Icelandic males, and about 28% of
Finnish
Finnish may refer to:
* Something or someone from, or related to Finland
* Culture of Finland
* Finnish people or Finns, the primary ethnic group in Finland
* Finnish language, the national language of the Finnish people
* Finnish cuisine
See also ...
males.
Bryan Sykes
Bryan Clifford Sykes (9 September 1947 – 10 December 2020) was a British geneticist and science writer who was a Fellow of Wolfson College and Emeritus Professor of human genetics at the University of Oxford.[Wodan
Odin (; from non, Óðinn, ) is a widely revered god in Germanic paganism. Norse mythology, the source of most surviving information about him, associates him with wisdom, healing, death, royalty, the gallows, knowledge, war, battle, victor ...]
".
All known living members descend from a common ancestor 6 times younger than the common ancestor with I2.
Before a reclassification in 2008, the group was known as ''I1a'', a name that has since been reassigned to a primary branch, haplogroup I-DF29. The other primary branches of I1 (M253) are I1b (S249/Z131) and I1c (Y18119/Z17925).
Origins
While haplogroup I1 most likely diverged from I* as early as 27,000 years ago in the
Gravettian
The Gravettian was an archaeological industry of the European Upper Paleolithic that succeeded the Aurignacian circa 33,000 years BP. It is archaeologically the last European culture many consider unified, and had mostly disappeared by 2 ...
, so far DNA studies have only been able to locate it in three
Paleolithic
The Paleolithic or Palaeolithic (), also called the Old Stone Age (from Greek: παλαιός '' palaios'', "old" and λίθος ''lithos'', "stone"), is a period in human prehistory that is distinguished by the original development of stone too ...
and
Mesolithic
The Mesolithic ( Greek: μέσος, ''mesos'' 'middle' + λίθος, ''lithos'' 'stone') or Middle Stone Age is the Old World archaeological period between the Upper Paleolithic and the Neolithic. The term Epipaleolithic is often used synonymo ...
hunter-gatherers. As of November 2022, only 6 ancient DNA samples from human remains dating to earlier than the Nordic Bronze Age have been assigned to haplogroup I1:
* 2 in Spain 24000 BP and 13000 BP.
* Burial SF11 Date: 7500 BP - The first is a DNA sample from a
Scandinavian hunter-gatherer with the label SF11 found on
Stora Karlsö on
Gotland
Gotland (, ; ''Gutland'' in Gutnish), also historically spelled Gottland or Gothland (), is Sweden's largest island. It is also a province, county, municipality, and diocese. The province includes the islands of Fårö and Gotska Sandön to ...
. SF11 was found to have carried 9 of the 312 SNPs that define haplogroup I1. SF11 was classified as I1-Z2699*.
SF11 was not assigned to a specific archaeological culture due to the skeleton being found in the Stora Förvar cave on Stora Karlsö.
* Burial BAB5 Date: 7300-5900 BP - The second is an individual sample from Balatonszemes-Bagodomb labelled BAB5, from Neolithic
Hungary
Hungary ( hu, Magyarország ) is a landlocked country in Central Europe. Spanning of the Carpathian Basin, it is bordered by Slovakia to the north, Ukraine to the northeast, Romania to the east and southeast, Serbia to the south, Cr ...
.
BAB5 was found to have carried 1 of the 312 SNPs that define haplogroup I1. BAB5 may also be classified as I1-Z2699*. BAB5 had a genetic affinity to other contemporary
Neolithic farmers of
Central Europe
Central Europe is an area of Europe between Western Europe and Eastern Europe, based on a common historical, social and cultural identity. The Thirty Years' War (1618–1648) between Catholicism and Protestantism significantly shaped the a ...
.
* Burial RISE179 Date: 4010-3776 BP - Additionally, the third ancient I1 sample is from an individual found in a
kurgan
A kurgan is a type of tumulus constructed over a grave, often characterized by containing a single human body along with grave vessels, weapons and horses. Originally in use on the Pontic–Caspian steppe, kurgans spread into much of Central As ...
burial dating to the late Neolithic Dagger Period in
Scandinavia
Scandinavia; Sámi languages: /. ( ) is a subregion in Northern Europe, with strong historical, cultural, and linguistic ties between its constituent peoples. In English usage, ''Scandinavia'' most commonly refers to Denmark, Norway, and S ...
labelled RISE179.
The grave is located close to Abbekås on the south coast of Skåne
RISE179 had a genetic affinity to the populations of the
Corded Ware culture
The Corded Ware culture comprises a broad archaeological horizon of Europe between ca. 3000 BC – 2350 BC, thus from the late Neolithic, through the Copper Age, and ending in the early Bronze Age. Corded Ware culture encompassed a v ...
and the
Unetice culture.
* Burial oll009 Date: 3930-3750 BP - The fourth ancient I1 sample predating the Nordic Bronze Age (1700–500 BCE) is labelled oll009 and was sequenced in the study titled "The genomic ancestry of the Scandinavian Battle Axe Culture people and their relation to the broader Corded Ware horizon". Oll009 is dated to the Scandinavian late Neolithic and was found in a burial in Sweden close to Öllsjö on the east coast of Skåne.
Similar to RISE179, he carried a high percentage of
Western Steppe-Herder ancestry and had a genetic affinity to the population of the
Battle Axe culture
The Battle Axe culture, also called Boat Axe culture, is a Chalcolithic culture that flourished in the coastal areas of the south of the Scandinavian Peninsula and southwest Finland, from circa 2800 BC to circa 2300 BC.
The Battle Axe culture wa ...
and other populations of the Corded Ware horizon. oll009 has Y11204 but does not seem to have Y164553 or Y11205.
Despite the high frequency of haplogroup I1 in present-day Scandinavians, I1 is completely absent among early agriculturalist DNA samples from Neolithic Scandinavia
(which also is the case with other haplogroups across Europe). Except for a single DNA sample (SF11), it is also absent from Mesolithic hunter-gatherers in Scandinavia. I1 first starts to appear in Scandinavia in notable frequency during the late Neolithic in conjunction with the entrance of groups carrying
Western Steppe Herder
In archaeogenetics, the term Western Steppe Herders (WSH), or Western Steppe Pastoralists, is the name given to a distinct ancestral component first identified in individuals from the Eneolithic steppe around the turn of the 5th millennium BCE, ...
ancestry into Scandinavia, but does not increase significantly in frequency until the beginning of the Nordic Bronze Age.
Due to the very low number of ancient DNA samples that have been assigned to I1 that date to earlier than the Nordic Bronze Age, it is currently unknown whether I1 was present as a rare haplogroup among Scandinavian forager cultures such as
Pitted Ware before becoming assimilated by the
Battle Axe culture
The Battle Axe culture, also called Boat Axe culture, is a Chalcolithic culture that flourished in the coastal areas of the south of the Scandinavian Peninsula and southwest Finland, from circa 2800 BC to circa 2300 BC.
The Battle Axe culture wa ...
, or if it was brought into Scandinavia by incoming groups such as Battle Axe who may have assimilated it from cultures such as the
Funnelbeaker culture
The Funnel(-neck-)beaker culture, in short TRB or TBK (german: Trichter(-rand-)becherkultur, nl, Trechterbekercultuur; da, Tragtbægerkultur; ) was an archaeological culture in north-central Europe.
It developed as a technological merger of lo ...
in Central Europe; or the steppe itself. Future research will most likely be able to determine which one of these two possible origins turns out to be the case.
Samples SF11 and BAB5 are unlike other ancient DNA samples assigned to I1 in the sense that they both seem to represent now-extinct branches of I1 that hadn't fully developed into I-M253 yet. They are therefore unlikely to have been ancestral to present-day carriers of I1, who all share a common ancestor that lived around 2600 BC.
According to a study published in 2010, I-M253 originated between 3,170 and 5,000 years ago, in
Chalcolithic Europe
The European Chalcolithic, the Chalcolithic (also Eneolithic, Copper Age) period of Prehistoric Europe, lasted roughly from 5000 to 2000 BC, developing from the preceding Neolithic period.
It was a period of Megalithic culture, the appearance o ...
.
[Pedro Soares, Alessandro Achilli, Ornella Semino, William Davies, Vincent Macaulay, Hans-Jürgen Bandelt, Antonio Torroni, and Martin B. Richards, The Archaeogenetics of Europe, ''Current Biology'', vol. 20 (February 23, 2010), R174–R183]
yDNA Haplogroup I: Subclade I1
Family Tree DNA, A new study in 2015 estimated the origin as between 3,470 and 5,070 years ago or between 3,180 and 3,760 years ago, using two different techniques.
In 2007, it was suggested that it initially dispersed from the area that is now
Denmark
)
, song = ( en, "King Christian stood by the lofty mast")
, song_type = National and royal anthem
, image_map = EU-Denmark.svg
, map_caption =
, subdivision_type = Sovereign state
, subdivision_name = Kingdom of Denmark
, establish ...
.
[Peter A. Underhill et al., New Phylogenetic Relationships for Y-chromosome Haplogroup I: Reappraising its Phylogeography and Prehistory, in ''Rethinking the Human Revolution'' (2007), pp. 33–42. P. Mellars, K. Boyle, O. Bar-Yosef, C. Stringer (Eds.) McDonald Institute for Archaeological Research, Cambridge, UK.]
However,
Prof. Dr. Kenneth Nordtvedt,
Montana State University
Montana State University (MSU) is a public land-grant research university in Bozeman, Montana. It is the state's largest university. MSU offers baccalaureate degrees in 60 fields, master's degrees in 68 fields, and doctoral degrees in 35 fie ...
, regarding the MRCA, in 2009 wrote in a personal message: "We don't know where that man existed, but the greater lower
Elbe
The Elbe (; cs, Labe ; nds, Ilv or ''Elv''; Upper and dsb, Łobjo) is one of the major rivers of Central Europe. It rises in the Giant Mountains of the northern Czech Republic before traversing much of Bohemia (western half of the Czech Re ...
basin seems like the heartland of I1".
Latest results (January 2022) published b
Y-Fullsuggest I1 (I-M253) was formed 27,500 ybp (
95 CI: 29,800 ybp – 25,200 ybp) with TMRCA 4,600 ybp (95 CI: 5,200 ybp – 4,000 ybp). Since the most up-to date calculated estimation of TMRCA of I1 is thought to be around 2600 BC, this likely puts the ancestor of all living I1 men somewhere in Northern Europe around that time. The phylogeny of I1 shows the signature of a rapid star-like expansion. This suggests that I1 went from being a rare marker to a rather common one in a rapid burst.
Structure
I-M253 (
M253, M307.2/P203.2, M450/S109, P30, P40, L64, L75, L80, L81, L118, L121/S62, L123, L124/S64, L125/S65, L157.1, L186, and L187) or I1
[ISOGG, ''Y-DNA Haplogroup I and its Subclades – 2017''](_blank)
(31 January 2017).
* ''I-DF29'' (DF29/S438); ''I1a''
** ''I-CTS6364'' (CTS6364/Z2336); ''I1a1''
*** FGC20030; I1a1a~
**** S4767; I1a1a1~
******* I-M227; I1a1a1a1a
**** A394; I1a1a2~
**** Y11221; I1a1a3~
**** A5338; I1a1a4~
*** CTS10028; I1a1b
**** I-L22 (L22/S142); I1a1b1
***** CTS11651/Z2338; I1a1b1a~
****** I-P109; I1a1b1a1
******* I-Y3662; I1a1b1a1e~
******** I-S14887; I1a1b1a1e2~
********* I-Y11203; I1a1b1a1e2d~
********** I-Y29630; I1a1b1a1e2d2~
****** CTS6017; I1a1b1a2
****** I-L205 (L205.1/L939.1/S239.1); I1a1b1a3
****** CTS6868; I1a1b1a4
******* I-Z74; I1a1b1a4a
******** CTS2208; I1a1b1a4a1~
********* I-L287; I1a1b1a4a1a
********** I-L258 (L258/S335); I1a1b1a4a1a1
******** I-L813; I1a1b1a4a2
******** FGC12562; I1a1b1a4a3~
***** CTS11603/S4744; I1a1b1b~
****** I-FT40464
******* I-Y19934
******** I-L300 (L300/S241); I1a1b1b1a1
******** I-Y19933
********* I-Y19932
********** I-Y22015
*********** I-FT57000
**** FGC10477/Y13056; I1a1b2
**** A8178, A8182, A8200, A8204; I1a1b3~
**** F13534.2/Y17263.2; I1a1b4~
** ''I-Z58'' (S244/Z58); ''I1a2''
*** I-Z59 (S246/Z59); I1a2a
**** I-Z60 (S337/Z60, S439/Z61, Z62); I1a2a1
***** I-Z140 (Z140, Z141)
****** I-L338
****** I-F2642 (F2642)
***** I-Z73
****** I-L1302
***** I-L573
***** I-L803
**** I-Z382; I1a2a2
*** I-Z138 (S296/Z138, Z139); I1a2b
**** I-Z2541
**
''I-Z63'' (S243/Z63); ''I1a3''
*** I-BY151; I1a3a
**** I-L849.2; I1a3a1
**** I-BY351; I1a3a2
****** I-CTS10345
******* I-Y10994
****** I-Y7075
**** I-S2078
***** I-S2077
****** I-Y2245 (Y2245/PR683)
******* I-L1237
******** I-FGC9550
******* I-S10360
******** I-S15301
******* I-Y7234
**** I-BY62 (BY62); I1a3a3
* ''I-Z131'' (Z131/S249); ''I1b''
** ''I-CTS6397''; ''I1b1''
* ''I-Z17943'' (Y18119/Z17925, S2304/Z17937); ''I1c''
Historical expansion
Haplogroup I1, as well as subclades of R1b such as R1b-U106 and subclades of R1a such as R1a-Z284, are strongly associated with
Germanic peoples
The Germanic peoples were historical groups of people that once occupied Central Europe and Scandinavia during antiquity and into the early Middle Ages. Since the 19th century, they have traditionally been defined by the use of ancient and ear ...
and are linked to the
proto-Germanic
Proto-Germanic (abbreviated PGmc; also called Common Germanic) is the reconstructed proto-language of the Germanic branch of the Indo-European languages.
Proto-Germanic eventually developed from pre-Proto-Germanic into three Germanic br ...
speakers of the
Nordic Bronze Age
The Nordic Bronze Age (also Northern Bronze Age, or Scandinavian Bronze Age) is a period of Scandinavian prehistory from c. 2000/1750–500 BC.
The Nordic Bronze Age culture emerged about 1750 BC as a continuation of the Battle Axe culture (th ...
. Current DNA research indicates that I1 was close to non-existent in most of Europe outside of
Scandinavia
Scandinavia; Sámi languages: /. ( ) is a subregion in Northern Europe, with strong historical, cultural, and linguistic ties between its constituent peoples. In English usage, ''Scandinavia'' most commonly refers to Denmark, Norway, and S ...
and
northern Germany
Northern Germany (german: link=no, Norddeutschland) is a linguistic, geographic, socio-cultural and historic region in the northern part of Germany which includes the coastal states of Schleswig-Holstein, Mecklenburg-Vorpommern and Lower Saxony an ...
before the
Migration Period
The Migration Period was a period in European history marked by large-scale migrations that saw the fall of the Western Roman Empire and subsequent settlement of its former territories by various tribes, and the establishment of the post-Roma ...
. The expansion of I1 is directly tied to that of the Germanic tribes. Starting around 900 BC, Germanic tribes started moving out of southern Scandinavia and northern Germany into the nearby lands between the Elbe and the Oder. Between 600 and 300 BC another wave of Germanics migrated across the Baltic Sea and settled alongside the
Vistula
The Vistula (; pl, Wisła, ) is the longest river in Poland and the ninth-longest river in Europe, at in length. The drainage basin, reaching into three other nations, covers , of which is in Poland.
The Vistula rises at Barania Góra in ...
. Germanic migration to that area resulted in the formation of the
Wielbark culture
The Wielbark culture (german: Wielbark-Willenberg-Kultur; pl, Kultura wielbarska) or East Pomeranian-Mazovian is an Iron Age archaeological complex which flourished on the territory of today's Poland from the 1st century AD to the 5th century AD. ...
, which is associated with the
Goths
The Goths ( got, 𐌲𐌿𐍄𐌸𐌹𐌿𐌳𐌰, translit=''Gutþiuda''; la, Gothi, grc-gre, Γότθοι, Gótthoi) were a Germanic people who played a major role in the fall of the Western Roman Empire and the emergence of medieval Euro ...
.
I1-Z63 has been traced to the Kowalewko burial site in Poland which dates to the
Roman Iron Age
The archaeology of Northern Europe studies the prehistory of Scandinavia and the adjacent North European Plain,
roughly corresponding to the territories of modern Sweden, Norway, Denmark, northern Germany, Poland and the Netherlands.
The regi ...
. In 2017 Polish researchers could successfully assign YDNA haplogroups to 16 individuals who were buried at the site. Out of these 16 individuals, 8 belonged to I1. In terms of subclades, three belonged to I-Z63, and in particular subclade I-L1237. The Kowalewko archeological site has been associated with the Wielbark culture. Therefore the subclade I-L1237 of I-Z63 may be seen somewhat as a genetic indicator of the Gothic tribe of late antiquity. I1-Z63 has also been found in a burial associated with Goth and
Lombard remains in Collegno, Italy. The cemetery is dated to the late 6th Century and further suggests that I1-Z63 and downstream subclades are linked to early Medieval Gothic migrations.
In 2015, a DNA study tested the Y-DNA haplogroups of 12 samples dated to 300-400 AD from
Saxony-Anhalt
Saxony-Anhalt (german: Sachsen-Anhalt ; nds, Sassen-Anholt) is a state of Germany, bordering the states of Brandenburg, Saxony, Thuringia and Lower Saxony. It covers an area of
and has a population of 2.18 million inhabitants, making i ...
in Germany. 8 of them belonged to haplogroup I1. This DNA evidence is in alignment with the historical migrations of Germanic tribes from Scandinavia to central Europe.
Additionally, I1-Z63 was found in the Late Antiquity site Crypta Balbi in Rome, this time with the downstream subclade I-Y7234. Material findings associated with the Lombards have been excavated in Crypta Balbi.
The Pla de l'Horta villa near
Girona
Girona (officially and in Catalan , Spanish: ''Gerona'' ) is a city in northern Catalonia, Spain, at the confluence of the Ter, Onyar, Galligants, and Güell rivers. The city had an official population of 103,369 in 2020. Girona is the capit ...
in Spain is located in close proximity to a necropolis with a series of tombs associated with the
Visigoths
The Visigoths (; la, Visigothi, Wisigothi, Vesi, Visi, Wesi, Wisi) were an early Germanic people who, along with the Ostrogoths, constituted the two major political entities of the Goths within the Roman Empire in late antiquity, or what is k ...
. The grave goods and the typology of the tombs point to a Visigothic origin of the individuals. A small number of individuals buried at the site were sampled for DNA analysis in a 2019 study. One of the samples belonged to haplogroup I1. This finding is in accordance with the common ancestral origin of the Visigoths and the
Ostrogoths
The Ostrogoths ( la, Ostrogothi, Austrogothi) were a Roman-era Germanic people. In the 5th century, they followed the Visigoths in creating one of the two great Gothic kingdoms within the Roman Empire, based upon the large Gothic populations who ...
.
The
Anglo-Saxon
The Anglo-Saxons were a cultural group who inhabited England in the Early Middle Ages. They traced their origins to settlers who came to Britain from mainland Europe in the 5th century. However, the ethnogenesis of the Anglo-Saxons happened wit ...
settlement of Britain introduced I1 in the British Isles.
During the
Viking Age
The Viking Age () was the period during the Middle Ages when Norsemen known as Vikings undertook large-scale raiding, colonizing, conquest, and trading throughout Europe and reached North America. It followed the Migration Period and the Germ ...
, I-M253 saw another expansion. Margaryan et al. 2020 analyzed 442 Viking world individuals from various archaeological sites in Europe. I-M253 was the most common Y-haplogroup found in the study. Norwegian and Danish Vikings brought more I1 to Britain and Ireland, while Swedish Vikings introduced it to Russia and Ukraine and brought more of it to Finland and Estonia.
Geographical distribution
I-M253 is found at its highest density in Northern Europe and other countries that experienced extensive migration from Northern Europe, either in the
Migration Period
The Migration Period was a period in European history marked by large-scale migrations that saw the fall of the Western Roman Empire and subsequent settlement of its former territories by various tribes, and the establishment of the post-Roma ...
, the
Viking Age
The Viking Age () was the period during the Middle Ages when Norsemen known as Vikings undertook large-scale raiding, colonizing, conquest, and trading throughout Europe and reached North America. It followed the Migration Period and the Germ ...
, or modern times. It is found in all places invaded by the Norse.
During the modern era, significant I-M253 populations have also taken root in immigrant nations and former European colonies such as the
United States
The United States of America (U.S.A. or USA), commonly known as the United States (U.S. or US) or America, is a country Continental United States, primarily located in North America. It consists of 50 U.S. state, states, a Washington, D.C., ...
,
Australia
Australia, officially the Commonwealth of Australia, is a sovereign country comprising the mainland of the Australian continent, the island of Tasmania, and numerous smaller islands. With an area of , Australia is the largest country by ...
,
New Zealand
New Zealand ( mi, Aotearoa ) is an island country in the southwestern Pacific Ocean. It consists of two main landmasses—the North Island () and the South Island ()—and over 700 smaller islands. It is the sixth-largest island coun ...
and
Canada
Canada is a country in North America. Its ten provinces and three territories extend from the Atlantic Ocean to the Pacific Ocean and northward into the Arctic Ocean, covering over , making it the world's second-largest country by to ...
.
In 2002 a paper was published by Michael E. Weale and colleagues showing genetic evidence for population differences between the English and Welsh populations, including a markedly higher level of Y-DNA haplogroup I1 in England than in Wales. They saw this as convincing evidence of Anglo-Saxon mass invasion of eastern Great Britain from
northern Germany
Northern Germany (german: link=no, Norddeutschland) is a linguistic, geographic, socio-cultural and historic region in the northern part of Germany which includes the coastal states of Schleswig-Holstein, Mecklenburg-Vorpommern and Lower Saxony an ...
and
Denmark
)
, song = ( en, "King Christian stood by the lofty mast")
, song_type = National and royal anthem
, image_map = EU-Denmark.svg
, map_caption =
, subdivision_type = Sovereign state
, subdivision_name = Kingdom of Denmark
, establish ...
during the
Migration Period
The Migration Period was a period in European history marked by large-scale migrations that saw the fall of the Western Roman Empire and subsequent settlement of its former territories by various tribes, and the establishment of the post-Roma ...
. The authors assumed that populations with large proportions of haplogroup I1 originated from northern Germany or southern Scandinavia, particularly Denmark, and that their ancestors had migrated across the
North Sea
The North Sea lies between Great Britain, Norway, Denmark, Germany, the Netherlands and Belgium. An epeiric sea on the European continental shelf, it connects to the Atlantic Ocean through the English Channel in the south and the Norwegian ...
with Anglo-Saxon migrations and
Danish Vikings
Vikings ; non, víkingr is the modern name given to seafaring people originally from Scandinavia (present-day Denmark, Norway and Sweden),
who from the late 8th to the late 11th centuries raided, pirated, traded and se ...
. The main claim by the researchers was
that an Anglo-Saxon immigration event affecting 50–100% of the Central English male gene pool at that time is required. We note, however, that our data do not allow us to distinguish an event that simply added to the indigenous Central English male gene pool from one where indigenous males were displaced elsewhere or one where indigenous males were reduced in number ... This study shows that the Welsh border was more of a genetic barrier to Anglo-Saxon Y chromosome gene flow than the North Sea ... These results indicate that a political boundary can be more important than a geophysical one in population genetic structuring.
In 2003 a paper was published by Christian Capelli and colleagues which supported, but modified, the conclusions of Weale and colleagues. This paper, which sampled Great Britain and Ireland on a grid, found a smaller difference between Welsh and English samples, with a gradual decrease in Haplogroup I1 frequency moving westwards in southern Great Britain. The results suggested to the authors that Norwegian Vikings invaders had heavily influenced the northern area of the British Isles, but that both English and mainland Scottish samples all have German/Danish influence.
Prominent members of I-M253
Alexander Hamilton
Alexander Hamilton (January 11, 1755 or 1757July 12, 1804) was an American military officer, statesman, and Founding Father who served as the first United States secretary of the treasury from 1789 to 1795.
Born out of wedlock in Charle ...
, through genealogy and the testing of his descendants (assuming actual paternity matching his genealogy), has been placed within Y-DNA haplogroup I-M253.
The
Varangian
The Varangians (; non, Væringjar; gkm, Βάραγγοι, ''Várangoi'';[Varangian]
" Online Etymo ...
Šimon Šimon (Old Norse: ''Sigmundr'') was a Varangian (Viking) whose story is related in the Kievan '' Patericon'' and his story concerns the creation of the Kievan cave monastery, where he is reported to have been its most important donor.
Story
Šimo ...
, who was said to have been the founder of the Russian
Vorontsov
Vorontsov (russian: Воронцо́в), also Woroncow and de Woroncow-Wojtkowicz,is the name of a Russian noble family whose members attained the dignity of Counts of the Holy Roman Empire in 1744 and became Princes of the Russian Empire in ...
noble family, belonged to haplogroup I1-Y15024. Testing by geneticist Peter Sjölund and
FamilyTreeDNA
FamilyTreeDNA is a division of Gene by Gene, a commercial genetic testing company based in Houston, Texas. FamilyTreeDNA offers analysis of autosomal DNA, Y-DNA, and mitochondrial DNA to individuals for genealogical purpose. With a database of m ...
showed that the present-day male members of the Vorontsov family still carry this subclade of I1, and downstream subclades. Other historical members of the Vorontsov family were Prince
Mikhail Semyonovich Vorontsov
Prince Mikhail Semyonovich Vorontsov (russian: Князь Михаи́л Семёнович Воронцо́в, tr. ; ) was a Russian nobleman and field-marshal, renowned for his success in the Napoleonic wars and most famous for his participati ...
and
Illarion Ivanovich Vorontsov-Dashkov
Count Illarion Ivanovich Vorontsov-Dashkov (russian: Илларио́н Ива́нович Воронцов-Дашков; 27 May 1837 – 15 January 1916) was a notable representative of the Vorontsov family. He served as Minister of Imperial Pro ...
.
The
Rurikid
The Rurik dynasty ( be, Ру́рыкавічы, Rúrykavichy; russian: Рю́риковичи, Ryúrikovichi, ; uk, Рю́риковичі, Riúrykovychi, ; literally "sons/scions of Rurik"), also known as the Rurikid dynasty or Rurikids, was ...
Prince
Sviatopolk the Accursed (son of
Vladimir the Great
Vladimir I Sviatoslavich or Volodymyr I Sviatoslavych ( orv, Володимѣръ Свѧтославичь, ''Volodiměrъ Svętoslavičь'';, ''Uladzimir'', russian: Владимир, ''Vladimir'', uk, Володимир, ''Volodymyr''. Se ...
) was found to likely have carried the I1-S2077 subclade of I1-Z63.
Birger Jarl
Birger Jarl, also known as ''Birger Magnusson'' (21 October 1266), was a Swedish statesman, ''jarl'', and a member of the House of Bjelbo, who played a pivotal role in the consolidation of Sweden. Birger also led the Second Swedish Crusade, w ...
, 'Duke of Sweden' of the East Geatish
House of Bjälbo
The House of Bjelbo ( sv, Bjälboätten), also known as the House of Folkung (''Folkungaätten''), was an Östergötland, Ostrogothian Swedish family that provided several medieval Swedish bishops, Jarl in Sweden, jarls and Monarchs of Sweden, k ...
, founder of
Stockholm
Stockholm () is the capital and largest city of Sweden as well as the largest urban area in Scandinavia. Approximately 980,000 people live in the municipality, with 1.6 million in the urban area, and 2.4 million in the metropo ...
; his remains were exhumed and tested in 2002 and found to be I-M253. The House of Bjälbo also provided three kings of
Norway
Norway, officially the Kingdom of Norway, is a Nordic countries, Nordic country in Northern Europe, the mainland territory of which comprises the western and northernmost portion of the Scandinavian Peninsula. The remote Arctic island of ...
, and one king of
Denmark
)
, song = ( en, "King Christian stood by the lofty mast")
, song_type = National and royal anthem
, image_map = EU-Denmark.svg
, map_caption =
, subdivision_type = Sovereign state
, subdivision_name = Kingdom of Denmark
, establish ...
in the 14th century.
Sting
Sting may refer to:
* Stinger or sting, a structure of an animal to inject venom, or the injury produced by a stinger
* Irritating hairs or prickles of a stinging plant, or the plant itself
Fictional characters and entities
* Sting (Middle-earth ...
was revealed to belong to haplogroup I1 by the PBS TV series Finding Your Roots.
William Bradford (governor)
William Bradford ( 19 March 15909 May 1657) was an English Puritan separatist originally from the West Riding of Yorkshire in Northern England. He moved to Leiden in Holland in order to escape persecution from King James I of England, and then ...
of the Mayflower, proven through the Mayflower DNA Project
William Brewster (Mayflower passenger)
William Brewster (1566–6710 April 1644) was an English official and ''Mayflower'' passenger in 1620. In Plymouth Colony, by virtue of his education and existing stature with those immigrating from the Netherlands, being a Brownist (or Purita ...
of the Mayflower, proven through the Mayflower DNA Project
General Robert E. Lee
Robert Edward Lee (January 19, 1807 – October 12, 1870) was a Confederate general during the American Civil War, towards the end of which he was appointed the overall commander of the Confederate States Army. He led the Army of North ...
belonged to I-M253 based on DNA testing of his descendants as a part of the Lee DNA Project. Other prominent members of the Lee family of Virginia and Maryland were
Richard Lee I
Richard Lee I (1618 – 1 March 1664) (later nicknamed "The Immigrant") was the first member of the Lee family to live in America (although he also considered himself an English gentleman). Poor when he arrived in Virginia in 1639 on a ship w ...
and
Richard Henry Lee
Richard Henry Lee (January 20, 1732June 19, 1794) was an American statesman and Founding Father from Virginia, best known for the June 1776 Lee Resolution, the motion in the Second Continental Congress calling for the colonies' independence f ...
.
Robert I of Scotland
Robert I (11 July 1274 – 7 June 1329), popularly known as Robert the Bruce (Scottish Gaelic: ''Raibeart an Bruis''), was King of Scots from 1306 to his death in 1329. One of the most renowned warriors of his generation, Robert eventuall ...
, commonly known as Robert the Bruce, belonged to haplogroup I1. Descendant testing of Robert, 6th lord of Annandale de Brus, assigned the men of
Clan Bruce
Clan Bruce ( gd, Brùs) is a Lowlands Scottish clan. It was a Royal House in the 14th century, producing two kings of Scotland (Robert the Bruce and David II of Scotland), and a disputed High King of Ireland, Edward Bruce.
Origins
The surname ' ...
to ''I1-Y17395.''
The male members of the
House of Grimaldi
The House of Grimaldi ( , also , , ) is the current reigning house of the Principality of Monaco. The house was founded in 1160 by Grimaldo Canella in Genoa and became the ruling house of Monaco when Francesco Grimaldi captured Monaco in 1297 ...
were revealed to carry haplogroup I1 as a part of the Grimaldi Genealogy DNA project. The men of House Grimaldi belong to a Scandinavian subclade of I1, downstream of I1-Y3549.
President
Andrew Jackson
Andrew Jackson (March 15, 1767 – June 8, 1845) was an American lawyer, planter, general, and statesman who served as the seventh president of the United States from 1829 to 1837. Before being elected to the presidency, he gained fame as ...
belonged to haplogroup I1, based on results from the Jackson DNA project and from genealogy.
The Russian writer
Leo Tolstoy
Count Lev Nikolayevich TolstoyTolstoy pronounced his first name as , which corresponds to the romanization ''Lyov''. () (; russian: link=no, Лев Николаевич Толстой,In Tolstoy's day, his name was written as in pre-refor ...
was found to have carried I1. The testing of his male descendant Pyotr Tolstoy revealed that the males of the Tolstoy family carry I1-M253.
Snorri Sturluson
Snorri Sturluson ( ; ; 1179 – 22 September 1241) was an Icelandic historian, poet, and politician. He was elected twice as lawspeaker of the Icelandic parliament, the Althing. He is commonly thought to have authored or compiled portions of th ...
was found to likely have belonged to haplogroup I1. Y-DNA testing of his presumed descendants revealed an assignment to I-M253. Their results are available on YSearch.org.
The Swedish scientist and theologian
Emanuel Swedenborg
Emanuel Swedenborg (, ; born Emanuel Swedberg; 29 March 1772) was a Swedish pluralistic-Christian theologian, scientist, philosopher and mystic. He became best known for his book on the afterlife, ''Heaven and Hell'' (1758).
Swedenborg had a ...
and other male members of the Swedenborg noble family were found to belong to haplogroup I1-BY229, as a part of the I1-L1302 DNA project by Jakob Norstedt.
Siener van Rensburg
Nicolaas Pieter Johannes ("Niklaas" or "Siener") Janse van Rensburg (3 August 1864 – 11 March 1926) was a Boer from the South African Republic – also known as the Transvaal Republic – and later a citizen of South Africa who was cons ...
,
Boer
Boers ( ; af, Boere ()) are the descendants of the Dutch-speaking Free Burghers of the eastern Cape frontier in Southern Africa during the 17th, 18th, and 19th centuries. From 1652 to 1795, the Dutch East India Company controlled this are ...
patriotic figure and mystic, belonged to haplogroup I1.
Björn Wahlroos,
Finnish
Finnish may refer to:
* Something or someone from, or related to Finland
* Culture of Finland
* Finnish people or Finns, the primary ethnic group in Finland
* Finnish language, the national language of the Finnish people
* Finnish cuisine
See also ...
businessman and millionaire, was found to belong to haplogroup I1.
The Finnish mathematician
Rolf Nevanlinna
Rolf Herman Nevanlinna (né Neovius; 22 October 1895 – 28 May 1980) was a Finnish mathematician who made significant contributions to complex analysis.
Background
Nevanlinna was born Rolf Herman Neovius, becoming Nevanlinna in 1906 when his ...
belonged to I1-M253 based on the testing of his son Arne Nevanlinna by
Geni.com
Geni is an American commercial genealogy and social networking website, founded in 2006, and owned by MyHeritage, an Israeli private company, since November 2012. As of 2021, MyHeritage has kept its genealogical website separate from Geni's webs ...
.
Samuel Morse
Samuel Finley Breese Morse (April 27, 1791 – April 2, 1872) was an American inventor and painter. After having established his reputation as a portrait painter, in his middle age Morse contributed to the invention of a single-wire telegraph ...
was found to have carried haplogroup I1 as a part of the Morse DNA project.
Footballers
Sebastian Larsson
Bengt Ulf Sebastian Larsson (; born 6 June 1985) is a Swedish former professional footballer who played as a midfielder. Beginning his career at hometown club IFK Eskilstuna, Larsson was signed by Arsenal. He made three Premier League appearanc ...
and his father
Svante
Svante is the shortening for the Swedish male first name Svantepolk.
It originates from Slavic ancestors of first prominent Svantes in Sweden. The Slavic languages have the name which is rendered as Sviatopolk in Russian, Swiãtopôłk in Kashub ...
Larsson were found to belong to I1-Y24470 through the testing of a family member.
Felix Kjellberg
Felix Arvid Ulf Kjellberg ( , ; born 24 October 1989), better known as PewDiePie ( ), is a Swedish YouTuber known for his Let's Play videos and comedic formatted videos and shows. Kjellberg's popularity on YouTube and extensive media coverage ...
(PewDiePie) was found to belong to haplogroup I1-L22, according to testing by
23andMe
23andMe Holding Co. is a publicly held personal genomics and biotechnology company based in South San Francisco, California. It is best known for providing a direct-to-consumer genetic testing service in which customers provide a saliva sample ...
.
Swedish actor
Björn Andrésen
Björn Johan Andrésen (born 26 January 1955) is a Swedish actor and musician. He is best known for playing the 14-year-old Tadzio in Luchino Visconti's 1971 film adaptation of the 1912 Thomas Mann novella ''Death in Venice''. He also played a ...
belongs to haplogroup I1-L22 based on the
ftDNA and
23andMe
23andMe Holding Co. is a publicly held personal genomics and biotechnology company based in South San Francisco, California. It is best known for providing a direct-to-consumer genetic testing service in which customers provide a saliva sample ...
tests of one of his first cousins and one uncle on the paternal side as a part of their family research. Their ancestor Johan Andrésen lived on both sides of the Swedish-Norwegian border.
As a part of the Pine family DNA project, actor
Chris Pine
Chris Pine (born August 26, 1980) is an American actor. He is best known for his roles as James T. Kirk in the ''Star Trek'' reboot film series (2009–present), Steve Trevor in the DC Extended Universe films ''Wonder Woman'' (2017) and '' Wo ...
was found to belong to haplogroup I1-A13819.
Ice hockey defenceman
Börje Salming
Anders Börje Salming (; 17 April 1951 – 24 November 2022) was a Swedish ice hockey player. He was a defenceman who played professionally for 23 seasons, for the clubs Brynäs IF, Toronto Maple Leafs, Detroit Red Wings, and AIK. He spent ...
was found to carry I1-M253. On episode 6 of the first season of the Carina Bergfeldt show on Swedish television, geneticist Peter Sjölund helped Salming investigate his DNA to find out more about his
Sámi
The Sámi ( ; also spelled Sami or Saami) are a Finno-Ugric-speaking people inhabiting the region of Sápmi (formerly known as Lapland), which today encompasses large northern parts of Norway, Sweden, Finland, and of the Murmansk Oblast, Ru ...
roots.
Markers
The following are the technical specifications for known I-M253 haplogroup SNP and STR mutations.
Name: M253
:Type: SNP
:Source: M (Peter Underhill o
Stanford University
:Position
ChrY:13532101..13532101 (+ strand):Position (base pair): 283
:Total size (base pairs): 400
:Length: 1
:ISOGG HG: I1
:Primer F (Forward 5′→ 3′): GCAACAATGAGGGTTTTTTTG
:Primer R (Reverse 5′→ 3′): CAGCTCCACCTCTATGCAGTTT
:YCC HG: I1
:Nucleotide alleles change (mutation):
C to
T
Name: M307
:Type: SNP
:Source: M (Peter Underhill)
:Position
ChrY:21160339..21160339 (+ strand):Length: 1
:ISOGG HG: I1
:Primer F: TTATTGGCATTTCAGGAAGTG
:Primer R: GGGTGAGGCAGGAAAATAGC
:YCC HG: I1
:Nucleotide alleles change (mutation):
G to
A
Name: P30
:Type: SNP
:Source: PS
Michael Hammerof th
University of Arizonaan
at the University of Edinburgh)
:Position
ChrY:13006761..13006761 (+ strand):Length: 1
:ISOGG HG: I1
:Primer F: GGTGGGCTGTTTGAAAAAGA
:Primer R: AGCCAAATACCAGTCGTCAC
:YCC HG: I1
:Nucleotide alleles change (mutation): G to A
:Region: ARSDP
Name: P40
P40
/ref>
:Type: SNP
:Source: PS (Michael Hammer and James F. Wilson)
:Position
ChrY:12994402..12994402 (+ strand)
:Length: 1
:ISOGG HG: I1
:Primer F: GGAGAAAAGGTGAGAAACC
:Primer R: GGACAAGGGGCAGATT
:YCC HG: I1
:Nucleotide alleles change (mutation): C to T
:Region: ARSDP
See also
* European ethnic groups
Europeans are the focus of European ethnology, the field of anthropology related to the various ethnic groups that reside in the states of Europe. Groups may be defined by common genetic ancestry, common language, or both. Pan and Pfeil (200 ...
* Genetic history of Europe
* Germanic peoples
The Germanic peoples were historical groups of people that once occupied Central Europe and Scandinavia during antiquity and into the early Middle Ages. Since the 19th century, they have traditionally been defined by the use of ancient and ear ...
* History of Normandy
Normandy was a province in the North-West of France under the Ancien Régime which lasted until the latter part of the 18th century. Initially populated by Celtic tribes in the West and Belgic tribes in the North East, it was conquered in AD&nbs ...
* Human Y-chromosome DNA haplogroups
In human genetics, a human Y-chromosome DNA haplogroup is a haplogroup defined by mutations in the non- recombining portions of DNA from the male-specific Y chromosome (called Y-DNA). Many people within a haplogroup share similar numbers of ...
* Late Glacial Maximum
The Last Glacial Maximum (LGM), also referred to as the Late Glacial Maximum, was the most recent time during the Last Glacial Period that ice sheets were at their greatest extent.
Ice sheets covered much of Northern North America, Northern Eur ...
* Neolithic Europe
The European Neolithic is the period when Neolithic (New Stone Age) technology was present in Europe, roughly between 7000 BCE (the approximate time of the first farming societies in Greece) and c.2000–1700 BCE (the beginning of the Bronze Ag ...
* Norse colonization of the Americas
The Norse exploration of North America began in the late 10th century, when Norsemen explored areas of the North Atlantic colonizing Greenland and creating a short term settlement near the northern tip of Newfoundland. This is known now as L'An ...
* Norse Sagas
is a series of science fantasy role-playing video games by Square Enix. The series originated on the Game Boy in 1989 as the creation of Akitoshi Kawazu at Square. It has since continued across multiple platforms, from the Super NES to t ...
References
Further reading
*
*
*
*
*
External links
;Haplogroup I databases
Haplogroup I1 Project at FTDNA
Danish Demes Regional DNA Project at FTDNA
Haplogroup I-P109 Project
British Isles DNA Project
;General Y-DNA databases
There are several public access databases featuring I-M253, including:
# http://www.ysearch.org/
# http://www.yhrd.org/
# http://www.yfull.com/tree/I1/
{{DEFAULTSORT:Haplogroup I-M253 (Y-Dna)
I-M253
Nordic Stone Age
Stone Age Europe