Haplogroup G2a3b1 (Y-DNA)
   HOME

TheInfoList



OR:

In
human genetics Human genetics is the study of inheritance as it occurs in human beings. Human genetics encompasses a variety of overlapping fields including: classical genetics, cytogenetics, molecular genetics, biochemical genetics, genomics, population gene ...
, Haplogroup G-P303 (G2a2b2a, formerly G2a3b1) is a
Y-chromosome The Y chromosome is one of two sex chromosomes (allosomes) in therian mammals, including humans, and many other animals. The other is the X chromosome. Y is normally the sex-determining chromosome in many species, since it is the presence or abse ...
haplogroup A haplotype is a group of alleles in an organism that are inherited together from a single parent, and a haplogroup (haploid from the el, ἁπλοῦς, ''haploûs'', "onefold, simple" and en, group) is a group of similar haplotypes that share ...
. It is a branch of
haplogroup G (Y-DNA) Haplogroup G (M201) is a human Y-chromosome haplogroup. It is one of two branches of the parent haplogroup GHIJK, the other being Haplogroup HIJK, HIJK. G-M201 is most commonly found among various ethnic groups of the Caucasus, but is also wide ...
(M201). In descending order, G-P303 is additionally a branch of G2 (P287), G2a (P15), G2a2, G2a2b, G2a2b2, and finally G2a2b2a. This haplogroup represents the majority of haplogroup G men in most areas of
Europe Europe is a large peninsula conventionally considered a continent in its own right because of its great physical size and the weight of its history and traditions. Europe is also considered a Continent#Subcontinents, subcontinent of Eurasia ...
west of
Russia Russia (, , ), or the Russian Federation, is a List of transcontinental countries, transcontinental country spanning Eastern Europe and North Asia, Northern Asia. It is the List of countries and dependencies by area, largest country in the ...
and the
Black Sea The Black Sea is a marginal mediterranean sea of the Atlantic Ocean lying between Europe and Asia, east of the Balkans, south of the East European Plain, west of the Caucasus, and north of Anatolia. It is bounded by Bulgaria, Georgia, Roma ...
. To the east, G-P303 is found among G persons across the
Middle East The Middle East ( ar, الشرق الأوسط, ISO 233: ) is a geopolitical region commonly encompassing Arabian Peninsula, Arabia (including the Arabian Peninsula and Bahrain), Anatolia, Asia Minor (Asian part of Turkey except Hatay Pro ...
,
Iran Iran, officially the Islamic Republic of Iran, and also called Persia, is a country located in Western Asia. It is bordered by Iraq and Turkey to the west, by Azerbaijan and Armenia to the northwest, by the Caspian Sea and Turkmeni ...
, the southern Caucasus area,
China China, officially the People's Republic of China (PRC), is a country in East Asia. It is the world's most populous country, with a population exceeding 1.4 billion, slightly ahead of India. China spans the equivalent of five time zones and ...
, and
India India, officially the Republic of India (Hindi: ), is a country in South Asia. It is the seventh-largest country by area, the second-most populous country, and the most populous democracy in the world. Bounded by the Indian Ocean on the so ...
. G-P303 exhibits its highest diversity in the Levant.


Genetic features

All G-P303 men carry the P303 or S135 SNP Y-DNA mutation. There are also some
short tandem repeat A microsatellite is a tract of repetitive DNA in which certain DNA motifs (ranging in length from one to six or more base pairs) are repeated, typically 5–50 times. Microsatellites occur at thousands of locations within an organism's genome ...
(STR) findings among G-P303 men which help in subgrouping them. Many of the men have an unusual value of 13 for marker DYS388, and some have 9 at DYS568. STR marker oddities are often different in each G-P303 subgroup, and characteristic marker values can vary by subgroup. Often the values of STR markers DYS391, DYS392 and DYS393, however, are respectively 10, 11 and 14 or some slight variation on these for all G-P303 men. P303 first became available for public testing in fall 2008, and the P designation indicates it was identified at the
University of Arizona The University of Arizona (Arizona, U of A, UArizona, or UA) is a public land-grant research university in Tucson, Arizona. Founded in 1885 by the 13th Arizona Territorial Legislature, it was the first university in the Arizona Territory. T ...
. The mutation is found on the Y chromosome at position 20104736. The forward primer is TTCTTATTTGCTTTGAAACTCAG. The reverse primer is ATTGGCTTATCAGATTGACG. The mutation involves replacement of T by C. This mutation was actually first identified as S135 at Ethnoancestry in London, England, but it took some time to realize that P303, which was independently identified, and S135 were the same.


Dating of G-P303 origin

Yfull dates TMRCA of all P303 in their database to 11,000 BP, and TMRCA with sibling PF3359 to 14,000. Yfull datings tend to be regarded as a quarter too young.


Old World geographical distribution

In Europe, G-P303 definable subgroups make up a majority of Haplogroup G persons west of
Russia Russia (, , ), or the Russian Federation, is a List of transcontinental countries, transcontinental country spanning Eastern Europe and North Asia, Northern Asia. It is the List of countries and dependencies by area, largest country in the ...
and the
Black Sea The Black Sea is a marginal mediterranean sea of the Atlantic Ocean lying between Europe and Asia, east of the Balkans, south of the East European Plain, west of the Caucasus, and north of Anatolia. It is bounded by Bulgaria, Georgia, Roma ...
, and small numbers are also found in
North Africa North Africa, or Northern Africa is a region encompassing the northern portion of the African continent. There is no singularly accepted scope for the region, and it is sometimes defined as stretching from the Atlantic shores of Mauritania in ...
. The
Baltic countries The Baltic states, et, Balti riigid or the Baltic countries is a geopolitical term, which currently is used to group three countries: Estonia, Latvia, and Lithuania. All three countries are members of NATO, the European Union, the Eurozone, ...
have the lowest population percentage of G-P303.
Scandinavia Scandinavia; Sámi languages: /. ( ) is a subregion#Europe, subregion in Northern Europe, with strong historical, cultural, and linguistic ties between its constituent peoples. In English usage, ''Scandinavia'' most commonly refers to Denmark, ...
is similar, showing less than half the percentages of G persons seen in the countries to the south. G-P303 seems to represent the same percentage of the population in both central and southern Europe, and usually represents half or more of the G seen in the population in these areas. G-P303 is also found among the
Crimean Karaites The Crimean Karaites or Krymkaraylar (Crimean Karaim: Кърымкъарайлар, ''Qrımqaraylar'', singular къарай, ''qaray''; Trakai dialect: ''karajlar'', singular ''karaj''; he, קראי מזרח אירופה; crh, Qaraylar; ), a ...
. To the east, G-P303 samples are found in North Africa (
Morocco Morocco (),, ) officially the Kingdom of Morocco, is the westernmost country in the Maghreb region of North Africa. It overlooks the Mediterranean Sea to the north and the Atlantic Ocean to the west, and has land borders with Algeria to ...
,
Tunisia ) , image_map = Tunisia location (orthographic projection).svg , map_caption = Location of Tunisia in northern Africa , image_map2 = , capital = Tunis , largest_city = capital , ...
,
Libya Libya (; ar, ليبيا, Lībiyā), officially the State of Libya ( ar, دولة ليبيا, Dawlat Lībiyā), is a country in the Maghreb region in North Africa. It is bordered by the Mediterranean Sea to the north, Egypt to Egypt–Libya bo ...
and
Egypt Egypt ( ar, مصر , ), officially the Arab Republic of Egypt, is a transcontinental country spanning the northeast corner of Africa and southwest corner of Asia via a land bridge formed by the Sinai Peninsula. It is bordered by the Mediter ...
), in the
Middle East The Middle East ( ar, الشرق الأوسط, ISO 233: ) is a geopolitical region commonly encompassing Arabian Peninsula, Arabia (including the Arabian Peninsula and Bahrain), Anatolia, Asia Minor (Asian part of Turkey except Hatay Pro ...
(
Israel Israel (; he, יִשְׂרָאֵל, ; ar, إِسْرَائِيل, ), officially the State of Israel ( he, מְדִינַת יִשְׂרָאֵל, label=none, translit=Medīnat Yīsrāʾēl; ), is a country in Western Asia. It is situated ...
(found among
Jews Jews ( he, יְהוּדִים, , ) or Jewish people are an ethnoreligious group and nation originating from the Israelites Israelite origins and kingdom: "The first act in the long drama of Jewish history is the age of the Israelites""The ...
,
Arabs The Arabs (singular: Arab; singular ar, عَرَبِيٌّ, DIN 31635: , , plural ar, عَرَب, DIN 31635, DIN 31635: , Arabic pronunciation: ), also known as the Arab people, are an ethnic group mainly inhabiting the Arab world in Wester ...
, and
Druze The Druze (; ar, دَرْزِيٌّ, ' or ', , ') are an Arabic-speaking esoteric ethnoreligious group from Western Asia who adhere to the Druze faith, an Abrahamic, monotheistic, syncretic, and ethnic religion based on the teachings of ...
),
Lebanon Lebanon ( , ar, لُبْنَان, translit=lubnān, ), officially the Republic of Lebanon () or the Lebanese Republic, is a country in Western Asia. It is located between Syria to the north and east and Israel to the south, while Cyprus li ...
,
Iran Iran, officially the Islamic Republic of Iran, and also called Persia, is a country located in Western Asia. It is bordered by Iraq and Turkey to the west, by Azerbaijan and Armenia to the northwest, by the Caspian Sea and Turkmeni ...
(reaching its highest at about 15% of Khuzestan Arabs),
Turkey Turkey ( tr, Türkiye ), officially the Republic of Türkiye ( tr, Türkiye Cumhuriyeti, links=no ), is a list of transcontinental countries, transcontinental country located mainly on the Anatolia, Anatolian Peninsula in Western Asia, with ...
,
Jordan Jordan ( ar, الأردن; tr. ' ), officially the Hashemite Kingdom of Jordan,; tr. ' is a country in Western Asia. It is situated at the crossroads of Asia, Africa, and Europe, within the Levant region, on the East Bank of the Jordan Rive ...
,
Saudi Arabia Saudi Arabia, officially the Kingdom of Saudi Arabia (KSA), is a country in Western Asia. It covers the bulk of the Arabian Peninsula, and has a land area of about , making it the fifth-largest country in Asia, the second-largest in the A ...
,
Yemen Yemen (; ar, ٱلْيَمَن, al-Yaman), officially the Republic of Yemen,, ) is a country in Western Asia. It is situated on the southern end of the Arabian Peninsula, and borders Saudi Arabia to the Saudi Arabia–Yemen border, north and ...
, and
Dubai Dubai (, ; ar, دبي, translit=Dubayy, , ) is the most populous city in the United Arab Emirates (UAE) and the capital of the Emirate of Dubai, the most populated of the 7 emirates of the United Arab Emirates.The Government and Politics of ...
), the
Caucasus Mountains The Caucasus Mountains, : pronounced * hy, Կովկասյան լեռներ, : pronounced * az, Qafqaz dağları, pronounced * rus, Кавка́зские го́ры, Kavkázskiye góry, kɐfˈkasːkʲɪje ˈɡorɨ * tr, Kafkas Dağla ...
area (
Armenia Armenia (), , group=pron officially the Republic of Armenia,, is a landlocked country in the Armenian Highlands of Western Asia.The UNbr>classification of world regions places Armenia in Western Asia; the CIA World Factbook , , and ''Ox ...
,
Georgia Georgia most commonly refers to: * Georgia (country), a country in the Caucasus region of Eurasia * Georgia (U.S. state), a state in the Southeast United States Georgia may also refer to: Places Historical states and entities * Related to the ...
,
Azerbaijan Azerbaijan (, ; az, Azərbaycan ), officially the Republic of Azerbaijan, , also sometimes officially called the Azerbaijan Republic is a transcontinental country located at the boundary of Eastern Europe and Western Asia. It is a part of th ...
,
Kabardinians The Kabardians (Kabardian Adyghe dialect, Highland Adyghe: Къэбэрдей адыгэхэр; West Adyghe dialect, Lowland Adyghe: Къэбэртай адыгэхэр; russian: Кабардинцы) or Kabardinians are one of the twelve ma ...
,
Abazinia Abazinia, Abazashta or Abaza is a historical country at the northern mountainside of the Caucasus Major, now the northern part of Karachay–Cherkess Republic, Russia. Abazinia is a home of the Abazins, a people related to the Abkhaz people t ...
,
Uzbekistan Uzbekistan (, ; uz, Ozbekiston, italic=yes / , ; russian: Узбекистан), officially the Republic of Uzbekistan ( uz, Ozbekiston Respublikasi, italic=yes / ; russian: Республика Узбекистан), is a doubly landlocked cou ...
, and scattered among ethnic groups of northwestern
China China, officially the People's Republic of China (PRC), is a country in East Asia. It is the world's most populous country, with a population exceeding 1.4 billion, slightly ahead of India. China spans the equivalent of five time zones and ...
and Russian
Siberia Siberia ( ; rus, Сибирь, r=Sibir', p=sʲɪˈbʲirʲ, a=Ru-Сибирь.ogg) is an extensive geographical region, constituting all of North Asia, from the Ural Mountains in the west to the Pacific Ocean in the east. It has been a part of ...
. A distinctive Indian type of G-P303 exists, but its prevalence is unclear. An isolated G-P303 sample from
Malaysia Malaysia ( ; ) is a country in Southeast Asia. The federation, federal constitutional monarchy consists of States and federal territories of Malaysia, thirteen states and three federal territories, separated by the South China Sea into two r ...
exists.


Concentrations of G-P303 at certain sites

The highest percentage of G-P303 persons in a discrete population so far described, 86%, is in the
Tuapsinsky District Tuapsinsky District (russian: Туапси́нский райо́н) is an administrative district (raion), one of the thirty-eight in Krasnodar Krai, Russia.Reference Information #34.01-707/13-03 As a municipal division, it is incorporated as Tu ...
,
Krasnodar Krai Krasnodar Krai (russian: Краснода́рский край, r=Krasnodarsky kray, p=krəsnɐˈdarskʲɪj kraj) is a federal subject of Russia (a krai), located in the North Caucasus region in Southern Russia and administratively a part of t ...
,
Russia Russia (, , ), or the Russian Federation, is a List of transcontinental countries, transcontinental country spanning Eastern Europe and North Asia, Northern Asia. It is the List of countries and dependencies by area, largest country in the ...
, among
Shapsugs The Shapsug ( ady, шапсыгъ , russian: шапсуги, tr, Şapsığlar, ar, الشابسوغ, he, שפסוגים) (also known as the Shapsugh or Shapsogh) are one of the twelve major Circassian tribes. Historically, the Shapsug tribe ...
. In Western Europe, one of the highest percentages is on the island of
Ibiza Ibiza (natively and officially in ca, Eivissa, ) is a Spanish island in the Mediterranean Sea off the eastern coast of the Iberian Peninsula. It is from the city of Valencia. It is the third largest of the Balearic Islands, in Spain. Its l ...
off the eastern Spanish coast. All of the available G samples from Ibiza are typical G-P303 samples based on STR marker values. In total, about 16% of its population is likely G-P303 on the same basis. These samples include many identifiable persons from the DYS388=13 subgroup, and are also commonly seen in
Sephardic Jewish Sephardic (or Sephardi) Jews (, ; lad, Djudíos Sefardíes), also ''Sepharadim'' , Modern Hebrew: ''Sfaradim'', Tiberian: Səp̄āraddîm, also , ''Ye'hude Sepharad'', lit. "The Jews of Spain", es, Judíos sefardíes (or ), pt, Judeus sefar ...
samples. Haplogroup G (P303) in Ibiza is likely representative of the significant population of
Crypto-Jews Crypto-Judaism is the secret adherence to Judaism while publicly professing to be of another faith; practitioners are referred to as "crypto-Jews" (origin from Greek ''kryptos'' – , 'hidden'). The term is especially applied historically to Sp ...
who came there fleeing the Spanish Expulsion and Inquisition. The percentage of haplogroup G among available samples from
Wales Wales ( cy, Cymru ) is a Countries of the United Kingdom, country that is part of the United Kingdom. It is bordered by England to the Wales–England border, east, the Irish Sea to the north and west, the Celtic Sea to the south west and the ...
is overwhelmingly G-P303. Such a high percentage is not found in nearby
England England is a country that is part of the United Kingdom. It shares land borders with Wales to its west and Scotland to its north. The Irish Sea lies northwest and the Celtic Sea to the southwest. It is separated from continental Europe b ...
,
Scotland Scotland (, ) is a country that is part of the United Kingdom. Covering the northern third of the island of Great Britain, mainland Scotland has a border with England to the southeast and is otherwise surrounded by the Atlantic Ocean to the ...
or
Ireland Ireland ( ; ga, Éire ; Ulster Scots dialect, Ulster-Scots: ) is an island in the Atlantic Ocean, North Atlantic Ocean, in Northwestern Europe, north-western Europe. It is separated from Great Britain to its east by the North Channel (Grea ...
.


G-P303+*

The asterisk indicates negativity for G-P303's only subgroup. This category was established in April, 2010 because of the determination then, that persons with the L140 SNP mutation comprise a separate subgroup of G-P303. G-M278, G-Z6885, G-Z30503 and G-L140 are the known subgroups


G-L140

Persons in this category have the L140 SNP mutation. L140 was identified at
Family Tree DNA FamilyTreeDNA is a division of Gene by Gene, a commercial genetic testing company based in Houston, Texas. FamilyTreeDNA offers analysis of autosomal DNA, YDNA, Y-DNA, and mitochondrial DNA to individuals for genealogical purpose. With a database ...
in 2009, but the determination that not all G-P303 person have this mutation was not made until April, 2010. This mutation is located at chromosome position 7630859, and is a deletion. The bulk of L140+ men belong to L140 subgroups.


G-U1 and its subgroups

U1 was first identified at the
University of Central Florida The University of Central Florida (UCF) is a public research university whose main campus is in unincorporated Orange County, Florida. UCF also has nine smaller regional campuses throughout central Florida. It is part of the State University ...
in 2006 but it was not described in a publication until 2009. The listed technical specifications are:....location rs9785956.....forward primer is TTTCTGCTCCAAATCTGCTG....reverse primer is CACCTGTAATCGGGAGGCTA....the mutation involves a change from A to G. A high percentage of all tested European U1+ persons so far are positive for the subgroup in which the L13 or S13 SNP mutation is present. In contrast the bulk of the non-Europeans (mostly in the western Caucasus Mountains) belong to the L1266 subgroup of U1.


= G-L13/S13

= Almost all L13+ persons of European ancestry have the value of 12 or 13 at STR marker DYS385a and values of 19,20 at STR marker YCA. There are a few L13+ samples available which lack these mutations, and a shared common ancestor farther back in time from the others can be presumed for these samples. The L13/S13 SNP was first identified at the
University of Central Florida The University of Central Florida (UCF) is a public research university whose main campus is in unincorporated Orange County, Florida. UCF also has nine smaller regional campuses throughout central Florida. It is part of the State University ...
in 2006 as the U13 SNP, but prior to the publication of the details of this research in 2009, the SNP was also independently identified in 2008 at
Family Tree DNA FamilyTreeDNA is a division of Gene by Gene, a commercial genetic testing company based in Houston, Texas. FamilyTreeDNA offers analysis of autosomal DNA, YDNA, Y-DNA, and mitochondrial DNA to individuals for genealogical purpose. With a database ...
in
Houston Houston (; ) is the most populous city in Texas, the most populous city in the Southern United States, the fourth-most populous city in the United States, and the sixth-most populous city in North America, with a population of 2,304,580 in ...
, Texas, as L13 and at Ethnoancestry in England as S13 and made available for public testing. The technical specifications are given as.....Y chromosome location rs9786706.....forward primer is GTGGTAACAGCTCCTGGTGAG.....reverse primer is TGCTGCTTTGGTTAACTGTCC...the mutation involves a change from C to T. The L13 subgroup is most common in north central Europe and is found in almost all places in Europe where other types of G are seen, but this subgroup seems uncommon in almost all countries outside Europe. Outside Europe L13 is seen most commonly in the Near East. The Haplogroup G Project has indicated among its large G collection that likely or proven G-L13 STR samples comprise the following percentages of available G samples in the following European countries n descending order Germany, 16%.....Italy, 11%.....Netherlands, 10%.....France, 10%.....Poland, 9%.....Spain, 9%.....Ireland, 6%.....England, 5%.....Switzerland, 4% A small, overwhelmingly English, subgroup of L13/S13 exists and is designated as L1263. This was first identified at Family Tree DNA in summer, 2012, and represents a mutation from G to A at chromosome position 8111187.


= G-L1266

= The L1266 mutation was first identified at
Family Tree DNA FamilyTreeDNA is a division of Gene by Gene, a commercial genetic testing company based in Houston, Texas. FamilyTreeDNA offers analysis of autosomal DNA, YDNA, Y-DNA, and mitochondrial DNA to individuals for genealogical purpose. With a database ...
in July, 2012. Early indications are that it encompasses a high percentage of U1 men who do not belong to U1's L13 subgroup. The L1266 mutation is found at position 15412419 on the chromosome and represents a mutation from A to G. Some L1266 men also belong to a L1266 subgroup consisting of men with the L1264, L1265 and L1268 mutations. These were identified at the same time as L1266 at Family Tree DNA. L1264 is at position 7704368, mutation A to G; L1265 at position 12741229, mutation A to G; and L1268 at position 20081319, T to C.


G-L497 subgroups

The largest subgroup in Europe based on available samples is with men having the L497 mutation. This SNP was first identified in January, 2011, in testing at
23andMe 23andMe Holding Co. is a publicly held personal genomics and biotechnology company based in South San Francisco, California. It is best known for providing a direct-to-consumer genetic testing service in which customers provide a saliva sample t ...
and made available for separate testing at L497 by
Family Tree DNA FamilyTreeDNA is a division of Gene by Gene, a commercial genetic testing company based in Houston, Texas. FamilyTreeDNA offers analysis of autosomal DNA, YDNA, Y-DNA, and mitochondrial DNA to individuals for genealogical purpose. With a database ...
. The chromosome locations are given as 15932714 and rs35141399, and the mutation is from C to T. The forward primer is ATGAGTGGCCTCACCAAGGGAATC and reverse primer is ATGGGCAACAGGTGTCCTGAAG. A high percentage of men with L497 have the value of 13 at STR marker DYS388. This is a rare mutation from the ancestral value of 12. A very small number of men within this DYS388=13 subgroup seem to have mutated yet again to 12 or 14. The geographical distribution of this 13 mutation and other features were first described in a research journal in 2007. Percentages of DYS388=13 men within G samples are particularly high in northwestern Europe. Some DYS388=13 subgroups below are based on SNP mutations and others on STR marker value oddities. Most L497 men belong to its subgroup Z725. The Haplogroup G Project has indicated among its large G collection that likely or proven STR samples from the DYS388=13 type, comprise the following percentages of available G samples in the following countries n descending order Switzerland, 74%.....Spain, 60%.....France, 58%....Germany, 57%.....England, 54%....Ireland, 48%.....Netherlands, 45%.....Italy, 43%....Poland, 29%....India, 0% The Polish percentage of DYS388=13 men is diminished solely because of the origins of a significant group of G2c men in that country. Without the G2c group, the DYS388=13 percentage is 50%. The German G samples are much more numerous in the southwestern part of the country. Based on marker values, the only non-European DYS388=13 sample that has surfaced from the
Old World The "Old World" is a term for Afro-Eurasia that originated in Europe , after Europeans became aware of the existence of the Americas. It is used to contrast the continents of Africa, Europe, and Asia, which were previously thought of by the ...
that has similar STR marker values to the Europeans is a single sample from Egypt. And the only SNP-proven L497+ men outside Europe in the Haplogroup G Project have Turkish ancestry. The paucity of proven samples from outside Europe so far leaves open the possibility this DYS388 mutation originated in a European.


G-Z725

Z725 was first identified by a citizen researcher among data for a single sample in the
1000 Genomes Project The 1000 Genomes Project (abbreviated as 1KGP), launched in January 2008, was an international research effort to establish by far the most detailed catalogue of human genetic variation. Scientists planned to sequence the genomes of at least one th ...
in summer 2011, but it was not until summer 2012 that it was confirmed in testing at
Family Tree DNA FamilyTreeDNA is a division of Gene by Gene, a commercial genetic testing company based in Houston, Texas. FamilyTreeDNA offers analysis of autosomal DNA, YDNA, Y-DNA, and mitochondrial DNA to individuals for genealogical purpose. With a database ...
as a separate subgroup. This L497 subgroup is the most common G subgroup in Europe because a high percentage of L497 men are also Z725+. Z725 is found at chromosome position 7957070 and is a deletion.


G-L43+/S147+, L42-/S146-

This subgroup is rare because virtually all tested L43+/S147+ persons so far are also L42+/S146+. The SNP was first identified in a listing of SNP results from testing at
23andMe 23andMe Holding Co. is a publicly held personal genomics and biotechnology company based in South San Francisco, California. It is best known for providing a direct-to-consumer genetic testing service in which customers provide a saliva sample t ...
. It was independently developed as a separate test by both
Family Tree DNA FamilyTreeDNA is a division of Gene by Gene, a commercial genetic testing company based in Houston, Texas. FamilyTreeDNA offers analysis of autosomal DNA, YDNA, Y-DNA, and mitochondrial DNA to individuals for genealogical purpose. With a database ...
as L43 and by Ethnoancestry as S147. In fall 2009 a test again at 23andMe provided information for the first time that a person who had the L43 mutation simultaneously lacked the L42 mutation that typically occurs with L43. This anomaly was verified by testing the same person at Family Tree DNA. So L43+/S147+ is now a separate category. The technical specifications for L43 are as follows: Y chromosome location 16446759....forward primer is GAGGTTTTCGGAGCTTACCTATAC....reverse primer is CACTGCTTGTAGATAGTAAAGTTTG.....the mutation involves change from A to G.


G-L43+/S147+, L42+/S146+

About a fourth of DYS388=13 men have this L42/S146 mutation. Swiss men are more likely than average to belong to this subgroup. L42/S146 could be nearly as old as the DYS388=13 mutation based on the number of value differences seen in 67-marker STR samples. The SNP was first identified in a listing of SNP results from testing at
23andMe 23andMe Holding Co. is a publicly held personal genomics and biotechnology company based in South San Francisco, California. It is best known for providing a direct-to-consumer genetic testing service in which customers provide a saliva sample t ...
. It was independently developed as a separate test by both
Family Tree DNA FamilyTreeDNA is a division of Gene by Gene, a commercial genetic testing company based in Houston, Texas. FamilyTreeDNA offers analysis of autosomal DNA, YDNA, Y-DNA, and mitochondrial DNA to individuals for genealogical purpose. With a database ...
as L42 and by Ethnoancestry as S146. The technical specifications for this SNP are as follows:....position on Y chromosome is 15170153.....forward primer is CTCACAATAGGCAGCATCCCCTCAG.....reverse primer is CAGAAAAAGGGAGCATATGACCAAGG.....the mutation involves a change from C to A.


DYS391=7

This multi-value (multistep) mutation at STR marker DYS391 to the value of 7 from the original 10 is found in a group of
Hispanic The term ''Hispanic'' ( es, hispano) refers to people, Spanish culture, cultures, or countries related to Spain, the Spanish language, or Hispanidad. The term commonly applies to countries with a cultural and historical link to Spain and to Vic ...
men.


DYS464a=9

This multi-value (multistep) mutation at STR marker DYS464a to the value of 9 is found so far only in Swiss and German men.


DYS388=15

This small subgroup is composed of men whose ancestor mutated two values at STR marker DYS388 to 15. Members of this subgroup must have other marker values similar to persons in the overall DYS388=13 subgroup. So far only persons of English ancestry belong to this DYS388=15 subgroup. Marker DYS388 rarely mutates, and a two-step (two-value) mutation is almost as valuable as a SNP mutation in identifying persons within this distinctive subgroup.


DYS393=12 with genetic nearness

This small subgroup is composed of men whose ancestor mutated at STR marker DYS393 to 12. This marker value is unusually low for G persons. The persons with this finding seem to report ancestral origins primarily in
Cyprus Cyprus ; tr, Kıbrıs (), officially the Republic of Cyprus,, , lit: Republic of Cyprus is an island country located south of the Anatolian Peninsula in the eastern Mediterranean Sea. Its continental position is disputed; while it is geo ...
based on current knowledge.


DYS594=12 with genetic nearness

While a mutation to a value of 12 from 10 or 11 is seen primarily in this group, there exist a few DYS594=12 men who do not belong to the group. The men in this group form a distinctive cluster of persons with closely related STR marker values in addition to the DYS594 oddity. This DYS594=12 subgroup has an unusually high percentage of Welsh surnames with the rest mostly of English ancestry based on available samples.


G-Z1903 subgroup

Z1903 men so far all have the value of 9 at STR marker DYS568 and less reliably 20,21 at marker YCA together with a close relationship based on STR marker values. The reason DYS568=9 can be used as a generally reliable categorization value is due to the fact this represents a multi-step mutation in a very slowly mutating marker. Although not the subject of a research study, the age of the mutation to 9 at DYS568 may have been about 3,000 yrs. ago based on the number of marker value differences of 67-marker STR samples. And the mutation to 20,21 at YCA would have arisen in this same general time period. Persons within the DYS568=9 group who were tested for the marker GATA-A10 had values one or more higher than found in other haplogroup G subgroups. Those from the Ashkenazi cluster had the highest values of 14. Additional results would be needed to determine if these findings are consistent within the DYS568=9 group. Almost all Z1903+ men have the additional Z724 mutation. Men who are Z1903+ and Z724- comprise only a small group within Z1903 and so far are only Hispanic men. Z1903 and Z724 were identified in 2011 in two samples in the
1000 Genomes Project The 1000 Genomes Project (abbreviated as 1KGP), launched in January 2008, was an international research effort to establish by far the most detailed catalogue of human genetic variation. Scientists planned to sequence the genomes of at least one th ...
, one from
Utah Utah ( , ) is a state in the Mountain West subregion of the Western United States. Utah is a landlocked U.S. state bordered to its east by Colorado, to its northeast by Wyoming, to its north by Idaho, to its south by Arizona, and to it ...
in the United States and other from
Beijing } Beijing ( ; ; ), alternatively romanized as Peking ( ), is the capital of the People's Republic of China. It is the center of power and development of the country. Beijing is the world's most populous national capital city, with over 21 ...
, China. Z1903 is found at chromosome position 15106340 and represents a mutation from A to G. Z724 is found at position 6895545 and represents a mutation from C to T The Z-series SNPs were identified by volunteer researchers. No Z1903 persons have so far been located in the Middle East or Anatolia region where haplogroup G can be unusually common. Several samples, however, have been found among Ossetians in the central
Caucasus Mountains The Caucasus Mountains, : pronounced * hy, Կովկասյան լեռներ, : pronounced * az, Qafqaz dağları, pronounced * rus, Кавка́зские го́ры, Kavkázskiye góry, kɐfˈkasːkʲɪje ˈɡorɨ * tr, Kafkas Dağla ...
and in a sample from
Beijing } Beijing ( ; ; ), alternatively romanized as Peking ( ), is the capital of the People's Republic of China. It is the center of power and development of the country. Beijing is the world's most populous national capital city, with over 21 ...
China. Though found all over Europe, Z1903 men are so far missing from Scandinavian samples north of Denmark. This Z1903/Z724 subgroup contains a further large subgroup consisting of
Ashkenazi Ashkenazi Jews ( ; he, יְהוּדֵי אַשְׁכְּנַז, translit=Yehudei Ashkenaz, ; yi, אַשכּנזישע ייִדן, Ashkenazishe Yidn), also known as Ashkenazic Jews or ''Ashkenazim'',, Ashkenazi Hebrew pronunciation: , singu ...
Jews who are relatively closely related based on STR marker values and typically have a value of 16 for marker DYS385b. The Jewish cluster does not seem to share a common ancestor with the non-Jewish men within the
Current Era Common Era (CE) and Before the Common Era (BCE) are year notations for the Gregorian calendar (and its predecessor, the Julian calendar), the world's most widely used calendar era. Common Era and Before the Common Era are alternatives to the or ...
. And the common ancestor of the Ashkenazi Z1903 men likely lived in the Middle Ages based on the small number of STR marker value difference seen among them. See also page covering
Jews with Haplogroup G (Y-DNA) Haplogroup G is found at modest percentages amongst Jewish men within multiple subgroups of haplogroup G (Y-DNA), with the majority falling within the G2b and G2c category. Haplogroups that are more commonly found amongst Jews are Haplogroups E and ...
. There is another, smaller subgroup of Z1903 persons who have the value of 9 at STR marker DYS439. The ancestral value for this marker is 12 within the DYS568=9 group, and this 9 represents a rare multi-step mutation. This DYS439=9 subgroup is predominantly German, and the mutation is probably over 2,000 years old based on number of marker value differences in 67-marker STR samples. The Haplogroup G Project has indicated among its large G collection that likely or proven DYS568=9 samples comprise the following percentages of available G samples in the following countries n descending order Ireland, 12%.....England, 9%.....Netherlands, 5%.....Poland, 5%.....Italy, 4%.....Germany, 3%.....Spain, 3%.....France, 2% Within the Z724 subgroup is a subgroup of G-L640+. This is a small group of men presently all from the British Isles. This SNP was identified in summer 2011 at Family Tree DNA. It represents a mutation from A to G and is found at position 16903082 on the Y chromosome. Most, if not all, these L640+ men also have the value of 8 at marker DY533 which is otherwise rare among Z724 men.


G-L660+, L662+

This subgroup is a small one, and so far found only in Europeans. Both SNPs involved were first identified at Family Tree DNA in summer 2011. L660 is found at position 12511525 on the Y chromosome and is a change from C to A. L662 is found at position 16446702 and is a change from C to T.


G-L694+

Persons in this subgroup have the L694 mutation which was discovered at
Family Tree DNA FamilyTreeDNA is a division of Gene by Gene, a commercial genetic testing company based in Houston, Texas. FamilyTreeDNA offers analysis of autosomal DNA, YDNA, Y-DNA, and mitochondrial DNA to individuals for genealogical purpose. With a database ...
in summer 2011. So far, this mutation has been found primarily in Polish men. It is located at position 5734987 on the Y chromosome and is an insertion mutation.


See also

*
Genetic genealogy Genetic genealogy is the use of genealogical DNA tests, i.e., DNA profiling and DNA testing, in combination with traditional genealogical methods, to infer genetic relationships between individuals. This application of genetics came to be used b ...
*
Y-DNA haplogroups by ethnic groups The various ethnolinguistic groups found in the Caucasus, Central Asia, Europe, the Middle East, North Africa and/or South Asia demonstrate differing rates of particular Y-DNA haplogroups. In the table below, the first two columns identify ethnoli ...
*
Haplogroup G (Y-DNA) Country by Country In human genetics, Haplogroup G (M201) is a Y-chromosome haplogroup None of the sampling done by research studies shown here would qualify as true random sampling, and thus any percentages of haplogroup G provided country by country are only rough ...


References


External links


Haplogroup G Project Site


from ''
National Geographic ''National Geographic'' (formerly the ''National Geographic Magazine'', sometimes branded as NAT GEO) is a popular American monthly magazine published by National Geographic Partners. Known for its photojournalism, it is one of the most widely ...
''
Haplogroup G tutorial from Genebase


* ttp://www.ysearch.org/haplosearch_results.asp?haplo=G®ion=&submit=Search&uid= Y-Search Users with Haplogroup G {{DEFAULTSORT:Haplogroup G-P303 (Y-Dna) G-P303