A guide RNA (gRNA) is a piece of
RNA
Ribonucleic acid (RNA) is a polymeric molecule essential in various biological roles in coding, decoding, regulation and expression of genes. RNA and deoxyribonucleic acid ( DNA) are nucleic acids. Along with lipids, proteins, and carbohydra ...
that functions as a guide for RNA- or DNA-targeting
enzymes
Enzymes () are proteins that act as biological catalysts by accelerating chemical reactions. The molecules upon which enzymes may act are called substrate (chemistry), substrates, and the enzyme converts the substrates into different molecule ...
, with which it forms
complexes. Very often these enzymes will delete, insert or otherwise alter the targeted RNA or DNA. They occur naturally, serving important functions, but can also be designed to be used for targeted editing, such as with
CRISPR-Cas9
Cas9 (CRISPR associated protein 9, formerly called Cas5, Csn1, or Csx12) is a 160 kilodalton protein which plays a vital role in the immunological defense of certain bacteria against DNA viruses and plasmids, and is heavily utilized in genetic ...
and CRISPR-Cas12.
History
RNA-editing Guide RNA was discovered in 1990 by B. Blum, N. Bakalara, and L. Simpson
in the mitochondria of protists called Leishmania tarentolae. The guide RNA there is encoded in maxicircle DNA and contains sequences matching those within the edited regions of the mRNA. They enable the cleavage, insertion and deletion of bases.
Guide RNA in Protists
Trypanosomatid
Trypanosomatida is a group of kinetoplastid excavates distinguished by having only a single flagellum. The name is derived from the Greek ''trypano'' (borer) and ''soma'' (body) because of the corkscrew-like motion of some trypanosomatid species ...
protists and other
kinetoplastids
Kinetoplastida (or Kinetoplastea, as a class) is a group of flagellated protists belonging to the phylum Euglenozoa, and characterised by the presence of an organelle with a large massed DNA called kinetoplast (hence the name). The organisms are ...
have a novel post-transcriptional mitochondrial RNA modification process known as "RNA editing". They have a large segment of highly organized DNA segments in their mitochondria. This mitochondrial DNA is circular and is divided into maxicircles and minicircles. A cell contains about 20-50
maxicircles which have both coding and non coding regions. The coding region is highly conserved (16-17kb) and the non-coding region varies depending on the species. Minicircles are small but more numerous than maxicircles. Minicircles constitute 95% of the mass of kinetoplastid DNA. Maxicircles can encode "
cryptogenes" and some gRNAs; minicircles can encode the majority of gRNAs. As many as 1000 gRNAs can be encoded by 250 or more minicircles. Some gRNA genes show identical insertion and deletion sites even if they have different sequences, whereas other gRNA sequences are not complementary to pre-edited mRNA. Maxicircles and minicircles molecules are catenated into a giant network of DNA that is situated at the base of the
flagellum
A flagellum (; ) is a hairlike appendage that protrudes from certain plant and animal sperm cells, and from a wide range of microorganisms to provide motility. Many protists with flagella are termed as flagellates.
A microorganism may have f ...
in the inner compartment of the single mitochondrion.
A majority of the maxicircle transcripts can not be translated into proteins due to multiple frameshifts in the sequences. These frameshifts are corrected after transcription by the insertion and deletion of
uridine
Uridine (symbol U or Urd) is a glycosylated pyrimidine analog containing uracil attached to a ribose ring (or more specifically, a ribofuranose) via a β-N1-glycosidic bond. The analog is one of the five standard nucleosides which make up nuclei ...
residues at precise sites which create an open reading frame that is translated into a mitochondrial protein homologous to mitochondrial proteins from other cells. The insertions and deletions are mediated by short guide RNA (gRNAs) which encode the editing information in the form of complementary sequences (allowing GU as well as GC base pairs).
gRNA-mRNA Complex
The guide RNA are mainly transcribed from the intergenic region of DNA maxicircle and these are complementary to mature mRNA. It is important for gRNA to interact initially with pre-edited mRNA and then its 5' region base pair with complementary mRNA . The 3' end of gRNA contains oligo 'U' tail (5-25 nucleotides in length) which is a non encoded region but interacts and forms a stable complex with A and G rich regions of mRNA. This initial hybrid helps in the recognition of specific mRNA site to be edited.
Function
The presence of two genomes in the mitochondrion, one of which contains sequence information that corrects errors in the other genome, is novel. Editing proceeds generally 3' to 5' on the mRNA. The initial editing event occurs when a gRNA forms an RNA duplex with a complementary mRNA sequence just downstream of the editing site. This then recruits a number of
ribonucleoprotein
Nucleoproteins are proteins conjugated with nucleic acids (either DNA or RNA). Typical nucleoproteins include ribosomes, nucleosomes and viral nucleocapsid proteins.
Structures
Nucleoproteins tend to be positively charged, facilitating in ...
complexes that direct the cleavage of the first mismatched base adjacent to the gRNA-mRNA anchor.
Uridylyltransferase
Nucleotidyltransferases are transferase enzymes of phosphorus-containing groups, e.g., substituents of nucleotidylic acids or simply nucleoside monophosphates. The general reaction of transferring a nucleoside monophosphate moiety from A to B, can ...
inserts 'U' at 3' terminal and RNA ligase is responsible for joining two cut ends. The adjacent upstream editing site is then modified in the same manner. A single gRNA usually encodes the information for several editing sites (an editing "block"), the editing of which produces a complete gRNA/mRNA duplex. This process of modification is termed as original enzyme cascade model.
In the case of "pan-edited" mRNAs, the duplex unwinds and another gRNA then forms a duplex with the edited mRNA sequence and initiates another round of editing. The overlapping gRNAs form an editing "domain". In some genes there are multiple editing domains. The extent of editing for any particular gene varies between trypanosomatid species. The variation consists of the loss of editing at the 3' side, probably due to the loss of minicircle sequence classes that encode specific gRNAs. A
retroposition
Retroposons are repetitive DNA fragments which are inserted into chromosomes after they had been reverse transcription, reverse transcribed from any RNA molecule.
Difference between retroposons and retrotransposons
In contrast to retrotransposon ...
model has been proposed to account for the partial, and in some cases, complete, loss of editing in evolution. Loss of editing is lethal in most cases, although losses have been seen in old laboratory strains. The maintenance of editing over the long evolutionary history of these ancient protists suggests the presence of a selective advantage, the exact nature of which is still uncertain.
It is not clear why trypanosomatids utilize such an elaborate mechanism to produce mRNAs. It may have originated in the early mitochondria of the ancestor of the kintoplastid protist lineage, since it is present in the
bodonids which are ancestral to the trypanosomatids, and may not be present in the
euglenoid
Euglenids (euglenoids, or euglenophytes, formally Euglenida/Euglenoida, ICZN, or Euglenophyceae, ICBN) are one of the best-known groups of flagellates, which are excavate eukaryotes of the phylum Euglenophyta and their cell structure is typical o ...
s, which branched from the same common ancestor as the kinetoplastids.
In the protozoan ''Leishmania tarentolae'', 12 of the 18 mitochondrial genes are edited using this process. One such gene is Cyb. The mRNA is actually edited twice in succession. For the first edit, the relevant sequence on the mRNA is as follows:
mRNA 5' AAAGAAAAGGCUUUAACUUCAGGUUGU 3'
The 3' end is used to anchor the gRNA (gCyb-I gRNA in this case) by basepairing (some G/U pairs are used). The 5' end does not exactly match and one of three specific
endonuclease
Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain. Some, such as deoxyribonuclease I, cut DNA relatively nonspecifically (without regard to sequence), while many, typically called restriction endonucleases ...
s cleaves the mRNA at the mismatch site.
gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' A A AGAAA A G G C UUUAACUUCAGGUUGU 3'
The mRNA is now "repaired" by adding U's at each editing site in succession, giving the following sequence:
gRNA 3' AAUAAUAAAUUUUUAAAUAUAAUAGAAAAUUGAAGUUCAGUA 5'
mRNA 5' UUAUUAUUUAGAAAUUUAUGUUGUCUUUUAACUUCAGGUUGU 3'
This particular gene has two overlapping gRNA editing sites. The 5' end of this section is the 3' anchor for another gRNA (gCyb-II gRNA)
Guide RNA in Prokaryotes
CRISPR In Prokaryotes
The majority of prokaryotes, which encompass bacteria and archaea, use
CRISPR (clustered regularly interspaced short palindromic repeats) with its associated Cas enzymes, as their adaptive immune system. When prokaryotes are infected by phages, and manage to fend off the attack, specific Cas enzymes will cut the phage DNA (or RNA) and integrate the parts in between the repeats of the CRISPR sequence. The stored segments can then be recognized in future virus attacks and Cas enzymes will use RNA copies of them, together with their associated CRISPR segments, as gRNA to identify the foreign sequences and render them harmless.
Structure
Guide RNA targets the complementary sequences by simple Watson-Crick base pairing. In type II CRISPR/cas system, single guide RNA (sgRNA) directs the target specific regions. Single guide RNA are artificially programmed combination of two RNA molecules, one component
(tracrRNA) is responsible for Cas9 endonuclease activity and other (crRNA) binds to the target specific DNA region. Therefore, the trans activating RNA (
tracrRNA In molecular biology, trans-activating crispr RNA (tracrRNA) is a small ''trans''-encoded RNA. It was first discovered by Emmanuelle Charpentier in her study of human pathogen ''Streptococcus pyogenes'', a type of bacteria that causes harm to human ...
) and crRNA are two key components and are joined by tetraloop which results in formation of sgRNA. TracrRNA are base pairs having a
stem loop
Stem-loop intramolecular base pairing is a pattern that can occur in single-stranded RNA. The structure is also known as a hairpin or hairpin loop. It occurs when two regions of the same strand, usually complementary in nucleotide sequence whe ...
structure in itself and attaches to the
endonuclease
Endonucleases are enzymes that cleave the phosphodiester bond within a polynucleotide chain. Some, such as deoxyribonuclease I, cut DNA relatively nonspecifically (without regard to sequence), while many, typically called restriction endonucleases ...
enzyme. Transcription of CRISPR locus gives CRISPR RNA (crRNA) which have spacer flanked region due to repeat sequences, consisting of 18-20 base pair. crRNA identifies the specific complementary target region which is cleaved by Cas9 after its binding with crRNA and tcRNA, which all together known as effector complex. With the modifications in the crRNA sequences of the guide RNA, the binding location can be changed and hence defining it as a user defined program.
Applications
Designing gRNAs
The targeting specificity of CRISPR-Cas9 is determined by the 20-nt sequence at the 5' end of the gRNA. The desired target sequence must precede the protospacer adjacent motif (PAM) which is a short DNA sequence usually 2-6 base pairs in length that follows the DNA region targeted for cleavage by the CRISPR system, such as CRISPR-Cas9. The PAM is required for a Cas nuclease to cut and is generally found 3-4 nucleotides downstream from the cut site. After base pairing of the gRNA to the target, Cas9 mediates a double-strand break about 3-nt upstream of PAM.
The GC content of the guide sequence should be 40-80%. High GC content stabilizes the RNA-DNA duplex while destabilizing off-target hybridization. The length of the guide sequence should be between 17-24bp noting a shorter sequence minimizes off-target effects. Guide sequences less than 17bp have a chance of targeting multiple loci.
CRISPR Cas9
CRISPR (Clustered regularly interspaced short palindromic repeats)/Cas9 is a technique used for gene editing and gene therapy. Cas is an endonuclease enzyme that cuts the DNA at a specific location directed by a guide RNA. This is a target-specific technique that can introduce gene knock out or knock in depending on the double strand repair pathway. Evidence shows that both in-vitro and in-vivo required tracrRNA for Cas9 and target DNA sequence binding. The CRISPR CAS9 system consists of three main stages. The first stage is extension of bases in the CRISPR locus region by addition of foreign DNA spacers in the genome sequence. Several different proteins, like cas1 and cas2, help in finding new spacers. The next stage involves transcription of CRISPR: pre-crRNA (precursor CRISPR RNA) are expressed by the transcription of CRISPR repeat-spacer array. On further modification in the pre-crRNA, they are converted to single spacer flanked regions forming short crRNA. RNA maturation process is similar in type I and II but different in type III, aRNA as tracers are added in this step. The third stage involves binding of cas9 protein and directing it to cleave the DNA segment. The Cas9 protein binds to a combined form of crRNA and tracrRNA forming an effector complex. This act as guide RNA for cas9 protein directing it for its endonuclease activity.
RNA mutagenesis
One important gene regulation method is RNA mutagenesis which can be introduced by RNA editing with the help of gRNA. Guide RNA replaces adenosine with inosine at the specific target site and modify the genetic code. Adenosine deaminase acts on RNA bringing post transcriptional modification by altering the codons and different protein functions. Guide RNAs are the small nucleolar RNA, these along with riboproteins perform intracellular RNA alterations such as ribomethylation in rRNA and introduction of pseudouridine in preribosomal RNA. Guide RNAs binds to the anti sense RNA sequence and regulates the RNA modification. It is observed that small interfering RNA (siRNA) and micro RNA (miRNA) are generally used as target RNA sequence and modifications are comparatively easy to introduce because of small size.
See also
* CRISPR gene editing
CRISPR gene editing (pronounced "crisper") is a genetic engineering technique in molecular biology by which the genomes of living organisms may be modified. It is based on a simplified version of the bacterial CRISPR-Cas9 antiviral defense sys ...
* CRISPR/Cas Tools
* SiRNA
Small interfering RNA (siRNA), sometimes known as short interfering RNA or silencing RNA, is a class of double-stranded RNA at first non-coding RNA molecules, typically 20-24 (normally 21) base pairs in length, similar to miRNA, and operating wi ...
* Gene knockout
A gene knockout (abbreviation: KO) is a genetic technique in which one of an organism's genes is made inoperative ("knocked out" of the organism). However, KO can also refer to the gene that is knocked out or the organism that carries the gene kno ...
* Protospacer adjacent motif
A protospacer adjacent motif (PAM) is a 2–6-base pair DNA sequence immediately following the DNA sequence targeted by the Cas9 nuclease in the CRISPR bacterial adaptive immune system. The PAM is a component of the invading virus or plasmid, but ...
References
Further reading
*Guide RNA-directed uridine insertion RNA editing in vitrohttp://www.jbc.org/content/272/7/4212.full
*
*
*
*
*
{{nucleic acids
Genome editing
RNA