NASBA (molecular Biology)
Nucleic acid sequence-based amplification, commonly referred to as NASBA, is a method in molecular biology which is used to produce multiple copies of single stranded RNA. NASBA is a two-step process that takes RNA and anneals specially designed primers, then utilizes an enzyme cocktail to amplify it. Background Nucleic acid amplification is a technique used to produce several copies of a specific segment of RNA/DNA. Amplified RNA and DNA can be used for a variety of applications, such as genotyping, sequencing, and detection of bacteria or viruses. There are two different types of amplification, non-isothermal and isothermal. Non-isothermal amplification produces multiple copies of RNA/DNA through reiterative cycling between different temperatures. Isothermal amplification produces multiple copies of RNA/DNA at a constant reaction temperature. NASBA takes single stranded RNA, anneals primers to it at 65℃, and then amplifies it at 41℃ to produce multiple copies of single strand ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Molecular Biology
Molecular biology is the branch of biology that seeks to understand the molecular basis of biological activity in and between cells, including biomolecular synthesis, modification, mechanisms, and interactions. The study of chemical and physical structure of biological macromolecules is known as molecular biology. Molecular biology was first described as an approach focused on the underpinnings of biological phenomena - uncovering the structures of biological molecules as well as their interactions, and how these interactions explain observations of classical biology. In 1945 the term molecular biology was used by physicist William Astbury. In 1953 Francis Crick, James Watson, Rosalind Franklin, and colleagues, working at Medical Research Council unit, Cavendish laboratory, Cambridge (now the MRC Laboratory of Molecular Biology), made a double helix model of DNA which changed the entire research scenario. They proposed the DNA structure based on previous research done by Ro ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Loop-mediated Isothermal Amplification
Loop-mediated isothermal amplification (LAMP) is a single-tube technique for the amplification of DNA and a low-cost alternative to detect certain diseases. Reverse transcription loop-mediated isothermal amplification (RT-LAMP) combines LAMP with a reverse transcription step to allow the detection of RNA. LAMP is an isothermal nucleic acid amplification technique. In contrast to the polymerase chain reaction (PCR) technology, in which the reaction is carried out with a series of alternating temperature steps or cycles, isothermal amplification is carried out at a constant temperature, and does not require a thermal cycler. Technique In LAMP, the target sequence is amplified at a constant temperature of 60–65 °C (140-149 °F) using either two or three sets of primers and a polymerase with high strand displacement activity in addition to a replication activity. Typically, 4 different primers are used to amplify 6 distinct regions on the target gene, which increases ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Polymerase Chain Reaction
The polymerase chain reaction (PCR) is a method widely used to rapidly make millions to billions of copies (complete or partial) of a specific DNA sample, allowing scientists to take a very small sample of DNA and amplify it (or a part of it) to a large enough amount to study in detail. PCR was invented in 1983 by the American biochemist Kary Mullis at Cetus Corporation; Mullis and biochemist Michael Smith (chemist), Michael Smith, who had developed other essential ways of manipulating DNA, were jointly awarded the Nobel Prize in Chemistry in 1993. PCR is fundamental to many of the procedures used in genetic testing and research, including analysis of Ancient DNA, ancient samples of DNA and identification of infectious agents. Using PCR, copies of very small amounts of DNA sequences are exponentially amplified in a series of cycles of temperature changes. PCR is now a common and often indispensable technique used in medical laboratory research for a broad variety of applications ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Reverse Transcriptase
A reverse transcriptase (RT) is an enzyme used to generate complementary DNA (cDNA) from an RNA template, a process termed reverse transcription. Reverse transcriptases are used by viruses such as HIV and hepatitis B to replicate their genomes, by retrotransposon mobile genetic elements to proliferate within the host genome, and by eukaryotic cells to extend the telomeres at the ends of their linear chromosomes. Contrary to a widely held belief, the process does not violate the flows of genetic information as described by the classical central dogma, as transfers of information from RNA to DNA are explicitly held possible. Retroviral RT has three sequential biochemical activities: RNA-dependent DNA polymerase activity, ribonuclease H (RNase H), and DNA-dependent DNA polymerase activity. Collectively, these activities enable the enzyme to convert single-stranded RNA into double-stranded cDNA. In retroviruses and retrotransposons, this cDNA can then integrate into the host genom ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Complementary DNA
In genetics, complementary DNA (cDNA) is DNA synthesized from a single-stranded RNA (e.g., messenger RNA (mRNA) or microRNA (miRNA)) template in a reaction catalyzed by the enzyme reverse transcriptase. cDNA is often used to express a specific protein in a cell that does not normally express that protein (i.e., heterologous expression), or to sequence or quantify mRNA molecules using DNA based methods (qPCR, RNA-seq). cDNA that codes for a specific protein can be transferred to a recipient cell for expression, often bacterial or yeast expression systems. cDNA is also generated to analyze transcriptomic profiles in bulk tissue, single cells, or single nuclei in assays such as microarrays, qPCR, and RNA-seq. cDNA is also produced naturally by retroviruses (such as HIV-1, HIV-2, simian immunodeficiency virus, etc.) and then integrated into the host's genome, where it creates a provirus. The term ''cDNA'' is also used, typically in a bioinformatics context, to refer to a ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Upstream And Downstream (DNA)
In molecular biology and genetics, upstream and downstream both refer to relative positions of genetic code in DNA or RNA. Each strand of DNA or RNA has a 5' end and a 3' end, so named for the carbon position on the deoxyribose (or ribose) ring. By convention, upstream and downstream relate to the 5' to 3' direction respectively in which RNA transcription takes place. Upstream is toward the 5' end of the RNA molecule and downstream is toward the 3' end. When considering double-stranded DNA, upstream is toward the 5' end of the coding strand for the gene in question and downstream is toward the 3' end. Due to the anti-parallel nature of DNA, this means the 3' end of the template strand is upstream of the gene and the 5' end is downstream. Some genes on the same DNA molecule may be transcribed in opposite directions. This means the upstream and downstream areas of the molecule may change depending on which gene is used as the reference. See also *Upstream and downstream (transdu ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
RNAse H
Ribonuclease H (abbreviated RNase H or RNH) is a family of non-sequence-specific endonuclease enzymes that catalyze the cleavage of RNA in an RNA/ DNA substrate via a hydrolytic mechanism. Members of the RNase H family can be found in nearly all organisms, from bacteria to archaea to eukaryotes. The family is divided into evolutionarily related groups with slightly different substrate preferences, broadly designated ribonuclease H1 and H2. The human genome encodes both H1 and H2. Human ribonuclease H2 is a heterotrimeric complex composed of three subunits, mutations in any of which are among the genetic causes of a rare disease known as Aicardi–Goutières syndrome. A third type, closely related to H2, is found only in a few prokaryotes, whereas H1 and H2 occur in all domains of life. Additionally, RNase H1-like retroviral ribonuclease H domains occur in multidomain reverse transcriptase proteins, which are encoded by retroviruses such as HIV and are required for viral repl ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
T7 RNA Polymerase
T7 RNA Polymerase is an RNA polymerase from the T7 bacteriophage that catalyzes the formation of RNA from DNA in the 5'→ 3' direction. Activity T7 polymerase is extremely promoter-specific and transcribes only DNA downstream of a T7 promoter. The T7 polymerase also requires a double stranded DNA template and Mg2+ ion as cofactor for the synthesis of RNA. It has a very low error rate. T7 polymerase has a molecular weight of 99 kDa. Promoter The promoter is recognized for binding and initiation of the transcription. The consensus in T7 and related phages is: 5' * 3' T7 TAATACGACTCACTATAGGGAGA T3 AATTAACCCTCACTAAAGGGAGA K11 AATTAGGGCACACTATAGGGAGA SP6 ATTTACGACACACTATAGAAGAA bind------------ -----------init Transcription begins at the asterisk-marked guanine. Structure T7 polymerase has been crystallised in several forms and the structures placed in the PDB. These explain how T7 polymerase binds to DNA and tra ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Foot-and-mouth Disease
Foot-and-mouth disease (FMD) or hoof-and-mouth disease (HMD) is an infectious and sometimes fatal viral disease that affects cloven-hoofed animals, including domestic and wild bovids. The virus causes a high fever lasting two to six days, followed by blisters inside the mouth and near the hoof that may rupture and cause lameness. FMD has very severe implications for animal farming, since it is highly infectious and can be spread by infected animals comparatively easily through contact with contaminated farming equipment, vehicles, clothing, and feed, and by domestic and wild predators. Its containment demands considerable efforts in vaccination, strict monitoring, trade restrictions, quarantines, and the culling of both infected and healthy (uninfected) animals. Susceptible animals include cattle, water buffalo, sheep, goats, pigs, antelope, deer, and bison. It has also been known to infect hedgehogs and elephants; llamas and alpacas may develop mild symptoms, but are resistant ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
SARS Coronavirus
Severe acute respiratory syndrome coronavirus 1 (SARS-CoV-1; or Severe acute respiratory syndrome coronavirus, SARS-CoV) is a strain of coronavirus that causes severe acute respiratory syndrome (SARS), the respiratory illness responsible for the 2002–2004 SARS outbreak. It is an enveloped, positive-sense, single-stranded RNA virus that infects the epithelial cells within the lungs. The virus enters the host cell by binding to angiotensin-converting enzyme 2. It infects humans, bats, and palm civets. On April 16, 2003, following the outbreak of SARS in Asia and secondary cases elsewhere in the world, the World Health Organization (WHO) issued a press release stating that the coronavirus identified by a number of laboratories was the official cause of SARS. The Centers for Disease Control and Prevention (CDC) in the United States and the National Microbiology Laboratory (NML) in Canada identified the SARS-CoV-1 genome in April 2003. Scientists at Erasmus University in Rotte ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
SARS
Severe acute respiratory syndrome (SARS) is a viral respiratory disease of zoonotic origin caused by the severe acute respiratory syndrome coronavirus (SARS-CoV or SARS-CoV-1), the first identified strain of the SARS coronavirus species, ''severe acute respiratory syndrome–related coronavirus'' (SARSr-CoV). The first known cases occurred in November 2002, and the syndrome caused the 2002–2004 SARS outbreak. In the 2010s, Chinese scientists traced the virus through the intermediary of Asian palm civets to cave-dwelling horseshoe bats in Xiyang Yi Ethnic Township, Yunnan.The locality was referred to be "a cave in Kunming" in earlier sources because the Xiyang Yi Ethnic Township is administratively part of Kunming, though 70 km apart. Xiyang was identified on * For an earlier interview of the researchers about the locality of the caves, see: SARS was a relatively rare disease; at the end of the epidemic in June 2003, the incidence was 8,469 cases with a case fatality rate (CFR ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |
|
Coronavirus
Coronaviruses are a group of related RNA viruses that cause diseases in mammals and birds. In humans and birds, they cause respiratory tract infections that can range from mild to lethal. Mild illnesses in humans include some cases of the common cold (which is also caused by other viruses, predominantly rhinoviruses), while more lethal varieties can cause SARS, MERS and COVID-19, which is causing the ongoing pandemic. In cows and pigs they cause diarrhea, while in mice they cause hepatitis and encephalomyelitis. Coronaviruses constitute the subfamily ''Orthocoronavirinae'', in the family ''Coronaviridae'', order '' Nidovirales'' and realm '' Riboviria''. They are enveloped viruses with a positive-sense single-stranded RNA genome and a nucleocapsid of helical symmetry. The genome size of coronaviruses ranges from approximately 26 to 32 kilobases, one of the largest among RNA viruses. They have characteristic club-shaped spikes that project from their surface, which in electr ... [...More Info...]       [...Related Items...]     OR:     [Wikipedia]   [Google]   [Baidu]   |